Changeset 570


Ignore:
Timestamp:
Feb 6, 2008, 11:22:04 AM (13 years ago)
Author:
Martin Svensson
Message:

References #89 Inserted the readme-text in wiki format.

File:
1 edited

Legend:

Unmodified
Added
Removed
  • trunk/net/sf/basedb/illumina/README

    r553 r570  
    11----------------------------------------------------------------------
    2 This is the Illumina plug-ins package for BASE.
     2{{{
     3Copyright (C) 2008
     4
     5This file is part of Illumina plug-in package for BASE.
     6Available at http://baseplugins.thep.lu.se/
     7BASE main site: http://base.thep.lu.se/
     8
     9This is free software; you can redistribute it and/or
     10modify it under the terms of the GNU General Public License
     11as published by the Free Software Foundation; either version 2
     12of the License, or (at your option) any later version.
     13
     14The software is distributed in the hope that it will be useful,
     15but WITHOUT ANY WARRANTY; without even the implied warranty of
     16MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
     17GNU General Public License for more details.
     18
     19You should have received a copy of the GNU General Public License
     20along with this program; if not, write to the Free Software
     21Foundation, Inc., 59 Temple Place - Suite 330,
     22Boston, MA  02111-1307, USA.
     23}}}
    324----------------------------------------------------------------------
    425
    5 ------------
    6 Requirements
    7 ------------
     26== Requirements ==
    827
    9 1. BASE 2.6.0 or later.
    10 2. Some Illumina scanner and software
    11    blah blah blah.
     28 1. BASE 2.6.0 or later.
     29 2. Illumina Bead Summary (IBS) files. The IBS files contain quantified probe intensities.
     30 3. Illumina Sentrix® Array binary manifest (BGX) file. The BGX files contain probe annotations.
     31 
     32Tested using Illumina BeadArray Reader (Version: 1.7.0.44) and BeadScan
     33(Version: 3.5.31.17122)  ## This is what we use in Lund.
    1234
    13 ------------
    14 Installation
    15 ------------
     35== Introduction ==
    1636
    17 See the INSTALL file.
     37The Illumina BeadArray Reader is a scanner that can read arrays including Illumina
     38Sentrix® BeadChips and Sentrix® Array Matrices (SAMs). Operation of the BeadArray
     39Reader and image aquisition from Sentrix® arrays is handled by the Illumina BeadScan
     40software.
    1841
     42The data output from a BeadArray Reader scanner by default consists of files
     43including image data (IDAT) files that can be read by data analysis software such
     44as the Illumina BeadStudio software.
    1945
     46The Illumina plug-ins package for BASE reads Illumina Sentrix® Array data from
     47Illumina Bead Summary (IBS) files. The IBS files are not by default outputted by
     48the BeadArray Reader and the scanner must be configured to do so. Once the
     49BeadArray Reader is configured it will output IBS files in addition to any default
     50output files. To configure a BeadArray Reader to output IBS files, users are asked
     51to contact their local Illumina Field Application Scientist.
     52
     53The IBS files are text files that contain bead-type level data for scanned Sentrix®
     54arrays. The file format is explained in detail in the section Illumina Bead Summary
     55files.
     56
     57== Illumina Bead Summary (IBS) files ==
     58
     59The IBS files contain bead-type level data for scanned Sentrix® arrays.
     60The IBS files are simple comma separated text files with file extension .csv.
     61The IBS files are outputted by the BeadArray Reader in the same directory as any
     62additional data files from a scan. Note that IBS files are not outputted by a
     63BeadArray Reader with default settings. Contact a local Illumina Field Application
     64Scientist to configure the scanner to output IBS files.
     65
     66IBS files are composed of four comma separated columns. See below for an example
     67IBS file including header and 3 rows of data.
     68{{{
     69  Illumicode,N,Mean GRN,Dev GRN
     70  10008,26,222,47
     71  10010,16,57,11
     72  10014,16,56,13
     73}}}
     74The column content in an IBS file is described below.
     75 - ''' Illumicode ''': A code corresponding to the Array_Address_Id in the
     76 Illumina Sentrix® Array binary manifest (BGX) file. Note that the Illuminacode is a string (or integer) of varying length. The Array_Address_Id is a string with a fixed lenght of 10 characters that consists of an Illuminacode padded with zeros.
     77 - ''' N ''': The total number of beads used to calculate Mean GRN and Dev GRN.
     78 - ''' Mean GRN ''': The mean intensity.
     79 - ''' Dev GRN ''': Standard deviation of the mean intensity.
     80
     81== Illumina Sentrix® Array binary manifest (BGX) files ==
     82
     83In addition to IDAT files, BeadStudio requires Illumina Sentrix® Array binary
     84manifest (BGX) files that contain information about the probes on a specific
     85Illumina Sentrix® Array, including gene symbol, probe sequence, and so on.
     86In BASE, the BGX files are used to create array designs that describe the probe
     87content of a specific Illumina Sentrix® Array.
     88
     89BGX files are tab separated text files composed of 3 sections named Heading,
     90Probes, and Controls respectively. The first section is the Heading section.
     91It is preceeded by a row containing the text [Heading]. In the Heading section
     92some information is presented including the number of Probes and Controls
     93described in the BGX file. See below for an example of the Heading section.
     94{{{
     95  [Heading]
     96  Date  1/3/2007
     97  ContentVersion  1.0
     98  FormatVersion 1.0.0
     99  Number of Probes  48701
     100  Number of Controls  1426
     101}}}
     102Following the Heading section is the Probes section wich is preceeded by a row
     103containing the text [Probes]. The first row of the Probes section, i.e., the row
     104after [Probes] contain the header for the Probes section. Following the Probes
     105section is the Controls section wich is preceeded by a row containing the text
     106[Controls]. The first row of the Controls section, i.e., the row after [Controls]
     107contain the header for the Controls section. Note that the header row for the
     108Controls section is completely different that the header row for the Probes section.
     109See below for an example of Probes header and Controls header and how information
     110in the BGX file is mapped to BASE.
     111
     112== Mapping reporter/control annotations from BGX files to BASE ==
     113
     114-> map to BASE; * Existing reporter annotation field in BASE; <new field>; -| do not map to BASE
     115[Probes] ## below are the columns present in the Probes section of the BGX file
     116 1. Species -> *Species
     117 2. Source -> <Source>
     118 3. Search_Key -> <Search_Key>
     119 4. Transcript -|
     120 5. ILMN_Gene -> <ILMN_Gene>
     121 6. Source_Reference_ID -> <Source_Reference_ID>
     122 7. RefSeq_ID -> *RefSeq
     123 8. Unigene_ID -> *Cluster ID
     124 9. Entrez_Gene_ID -> *LocusLink
     125 10. GI -|
     126 11. Accession -> *Accession
     127 12. Symbol -> *Gene symbol
     128 13. Protein_Product -|
     129 14. Probe_Id -> *reporter.externalId
     130 15. Array_Address_Id -> Feature.featureId
     131 16. Probe_Type -> <Isoform_Type>
     132 17. Probe_Start -|
     133 18. Probe_Sequence -> *Sequence
     134 19. Chromosome -> *Chromosome
     135 20. Probe_Chr_Orientation -> <Probe_Chr_Orientation>
     136 21. Probe_Coordinates -> <Probe_Chr_Coordinates>
     137 22. Definition -> *Name
     138 23. Ontology_Component -> *GO cell location
     139 24. Ontology_Process -> *GO biological process
     140 25. Ontology_Function -> *GO molecular function
     141 26. Synonyms -> <Synonyms>
     142
     143Example Probe
     144{{{
     1451. Homo sapiens
     1462. RefSeq
     1473. ILMN_5998
     1484. ILMN_5998
     1495. BRCA1
     1506. NM_007301.2
     1517. NM_007301.2
     1528.
     1539. 672
     15410. 63252878
     15511. NM_007301.2
     15612. BRCA1
     15713. NP_009232.1
     15814. ILMN_1738027
     15915. 0003120095
     16016. A
     16117. 6438
     16218. ATCCAGGACTGTTTATAGCTGTTGGAAGGACTAGGTCTTCCCTAGCCCCC
     16319. 17
     16420. -
     16521. 38449935-38449984
     16622. Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta15-17, mRNA.
     16723. ubiquitin ligase complex [goid 151] [pmid 14976165] [evidence NAS]; gamma-tubulin ring complex [goid 8274] [pmid 12214252] [evidence NAS]; intracellular [goid 5622] [evidence IEA]; nucleus [goid 5634] [pmid 10918303] [evidence TAS]; BRCA1-BARD1 complex [goid 31436] [pmid 15265711] [evidence IDA]
     16824. protein ubiquitination [goid 16567] [pmid 15905410] [evidence NAS]; regulation of apoptosis [goid 42981] [pmid 10918303] [evidence TAS]; cell cycle checkpoint [goid 75] [evidence NAS]; positive regulation of transcription, DNA-dependent [goid 45893] [pmid 15572661] [evidence NAS]; androgen receptor signaling pathway [goid 30521] [pmid 15572661] [evidence NAS]; cell cycle [goid 7049] [evidence IEA]; regulation of transcription from RNA polymerase II promoter [goid 6357] [pmid 10910365] [evidence TAS]; negative regulation of progression through cell cycle [goid 45786] [evidence IEA]; positive regulation of DNA repair [goid 45739] [pmid 12242698] [evidence NAS]; DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator [goid 6978] [pmid 10918303] [evidence TAS]; DNA damage response, signal transduction resulting in induction of apoptosis [goid 8630] [pmid 14654789] [evidence IDA]; regulation of transcription from RNA polymerase III promoter [goid 6359] [pmid 10918303] [evidence TAS]; negative regulation of centriole replication [goid 46600] [pmid 12214252] [evidence NAS]; regulation of cell proliferation [goid 42127] [pmid 10918303] [evidence TAS]; DNA repair [goid 6281] [evidence IEA]
     16925. metal ion binding [goid 46872] [evidence IEA]; transcription coactivator activity [goid 3713] [pmid 15572661] [evidence NAS]; DNA binding [goid 3677] [pmid 9662397] [evidence TAS]; androgen receptor binding [goid 50681] [pmid 15572661] [evidence NAS]; protein binding [goid 5515] [pmid 15265711] [evidence IPI]; ubiquitin-protein ligase activity [goid 4842] [pmid 15905410] [evidence NAS]; zinc ion binding [goid 8270] [pmid 8944023] [evidence TAS]; tubulin binding [goid 15631] [pmid 12214252] [evidence NAS]
     17026. IRIS; PSCP; BRCAI; BRCC1; RNF53
     171}}}
     172-> map to BASE; * Existing reporter annotation field in BASE; <new field>; -| do not map to BASE
     173[Controls]  ## below are the columns present in the Controls section of the BGX file
     174 1. Probe_Id -> *reporter.externalId
     175 2. Array_Address_Id -> Feature.featureId
     176 3. Reporter_Group_Name -> <Control_Group_Name>
     177 4. Reporter_Group_id -> <Control_Group_Id>
     178 5. Reporter_Composite_map -> <Control_Composite_map>
     179 6. Probe_Sequence -> *Sequence
     180
     181Example Control
     182{{{
     1831. ILMN_943471
     1842. 0004780609
     1853. housekeeping
     1864. housekeeping
     1875. GI_34304116-S
     1886. CGTGAAGACCCTGACTGGTAAGACCATCACTCTCGAAGTGGAGCCGAGTG
     189}}}
     190
     191== New raw data type ==
     192
     193 - name = Illumina Bead Summary (IBS)
     194 - id = illumina_bead_summary
Note: See TracChangeset for help on using the changeset viewer.