Changeset 1121

Feb 22, 2008, 4:29:56 PM (15 years ago)

fixes #308

69 edited
2 moved


  • trunk/test/

    r1098 r1121  
    2525#include "yat/utility/Alignment.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2929#include <gsl/gsl_cdf.h>
    7676             const std::vector<double>& l2,
    7777             const double sigma,
    78              theplu::yat::utility::matrix& dot_matrix,
     78             theplu::yat::utility::Matrix& dot_matrix,
    7979             std::vector<std::pair<size_t,size_t> >& path)
    109109  for (size_t i=0; i<peaksets.size()-1; i++)
    110110    for (size_t j=i+1; j<peaksets.size(); j++) {
    111       utility::matrix dot_m;
     111      utility::Matrix dot_m;
    112112      std::vector<std::pair<size_t,size_t> > path;
    113113      score(peaksets[i], peaksets[j], 1.0, dot_m, path);
    116116  std::string a("AGGUUGUCCGUGGUGAGUUCGCA");
    117117  std::string b("GAGGUUGUCCGUGGUGAGUUCG");
    118   utility::matrix m(a.size(), b.size());
     118  utility::Matrix m(a.size(), b.size());
    119119  for (size_t j=0; j<a.size(); ++j)
    120120    for (size_t k=0; k<b.size(); ++k)
  • trunk/test/

    r1000 r1121  
    2626#include "yat/classifier/ConsensusInputRanker.h"
    2727#include "yat/statistics/AUC.h"
    28 #include "yat/utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    2929#include "yat/classifier/MatrixLookup.h"
    3030#include "yat/classifier/CrossValidationSampler.h"
    5454  ifstream is("data/rank_data.txt");
    55   theplu::yat::utility::matrix data_tmp(is);
     55  theplu::yat::utility::Matrix data_tmp(is);
    5656  theplu::yat::classifier::MatrixLookup data(data_tmp);
    5757  is.close();
    8686    *error << "ok." << std::endl;
    88   theplu::yat::utility::matrix flag(data.rows(),data.columns(),1);
     88  theplu::yat::utility::Matrix flag(data.rows(),data.columns(),1);
    8989  // Peter, fix weighted version instead
    9090  theplu::yat::classifier::ConsensusInputRanker cir2(retrieve,median);
  • trunk/test/

    r1120 r1121  
    25 #include "yat/utility/matrix.h"
     25#include "yat/utility/Matrix.h"
    2626#include "yat/classifier/DataLookup1D.h"
    2727#include "yat/classifier/MatrixLookup.h"
    3737using namespace theplu::yat;
    39 utility::matrix matrix(size_t n);
     39utility::Matrix matrix(size_t n);
    4040int end_test(std::ostream*, bool);
    5858  *error << "Testing DataLookup1D" << std::endl;
    59   utility::matrix gsl_m1(matrix(5));
     59  utility::Matrix gsl_m1(matrix(5));
    6060  std::vector<size_t> index_odd;
    6161  index_odd.push_back(1);
    179 utility::matrix matrix(size_t n)
     179utility::Matrix matrix(size_t n)
    181   utility::matrix res(n,n);
     181  utility::Matrix res(n,n);
    182182  for (size_t i=0;i<n;i++)
    183183    for (size_t j=0;j<n;j++)
  • trunk/test/

    r1120 r1121  
    2626#include "yat/statistics/EuclideanDistance.h"
    2727#include "yat/statistics/PearsonDistance.h"
    28 #include "yat/utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    2929#include "yat/utility/Vector.h"
    7575  // Testing weighted versions
    76   utility::matrix m(2,3,1);
     76  utility::Matrix m(2,3,1);
    7777  m(0,1)=2;
    7878  m(1,0)=0;
    7979  m(1,1)=0;
    80   utility::matrix w(2,3,1);
     80  utility::Matrix w(2,3,1);
    8181  w(0,0)=0;
    8282  classifier::MatrixLookupWeighted mw(m,w);
  • trunk/test/

    r1100 r1121  
    25 #include "yat/utility/matrix.h"
     25#include "yat/utility/Matrix.h"
    2626#include "yat/classifier/SubsetGenerator.h"
    2727#include "yat/classifier/CrossValidationSampler.h"
    6262  *error << "loading data" << std::endl;
    6363  std::ifstream is("data/nm_data_centralized.txt");
    64   utility::matrix data_core(is);
     64  utility::Matrix data_core(is);
    6565  is.close();
  • trunk/test/

    r1000 r1121  
    3030#include "yat/statistics/SNRScore.h"
    32 #include "yat/utility/matrix.h"
     32#include "yat/utility/Matrix.h"
    3434#include <algorithm>
    6060  *error << "Reading in Sorlie data to identify top gene ..." << std::endl;
    6161  std::ifstream is("data/sorlie_centroid_data.txt");
    62   utility::matrix data(is,'\t');
     62  utility::Matrix data(is,'\t');
    6363  is.close();
    7171  // Generate weight matrix with 0 for missing values and 1 for others.
    72   utility::matrix weights(data.rows(),data.columns(),0.0);
     72  utility::Matrix weights(data.rows(),data.columns(),0.0);
    7373  for(size_t i=0;i<data.rows();++i)
    7474    for(size_t j=0;j<data.columns();++j)
  • trunk/test/

    r1000 r1121  
    2626#include "yat/classifier/InputRanker.h"
    2727#include "yat/statistics/AUC.h"
    28 #include "yat/utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    2929#include "yat/classifier/MatrixLookup.h"
    3030#include "yat/classifier/Target.h"
    5252  std::ifstream is("data/rank_data.txt");
    53   theplu::yat::utility::matrix data_tmp(is);
     53  theplu::yat::utility::Matrix data_tmp(is);
    5454  theplu::yat::classifier::MatrixLookup data(data_tmp);
    5555  is.close();
  • trunk/test/

    r1120 r1121  
    2727#include "yat/classifier/MatrixLookupWeighted.h"
    2828#include "yat/utility/Container2DIterator.h"
    29 #include "yat/utility/matrix.h"
     29#include "yat/utility/Matrix.h"
    3030#include "yat/utility/Vector.h"
    7474  // test std algorithm on IteratorWeighted
    75   utility::matrix m(1,3,1);
     75  utility::Matrix m(1,3,1);
    7676  m(0,1)=2.0;
    77   utility::matrix w(1,3,1);
     77  utility::Matrix w(1,3,1);
    7878  classifier::MatrixLookupWeighted mw(m,w);
    7979  classifier::DataLookupWeighted1D aw(mw,0,true);
  • trunk/test/

    r1000 r1121  
    24 #include "yat/utility/matrix.h"
     24#include "yat/utility/Matrix.h"
    2525#include "yat/classifier/DataLookup1D.h"
    2626#include "yat/classifier/KernelLookup.h"
    5050  bool ok =true;
    5151  *error << "\nTesting KernelLookup" << std::endl;
    52   utility::matrix data_core(1,5);
     52  utility::Matrix data_core(1,5);
    5353  for (size_t i=0; i<data_core.columns(); i++)
    5454    data_core(0,i)=i;
  • trunk/test/

    r1098 r1121  
    26 #include "yat/utility/matrix.h"
     26#include "yat/utility/Matrix.h"
    2727#include "yat/classifier/KernelFunction.h"
    2828#include "yat/classifier/PolynomialKernelFunction.h"
    4343bool test_MEV(const classifier::MatrixLookup& data,
    4444              const classifier::KernelFunction* kf,
    45               const utility::matrix& control, const double error_bound,
     45              const utility::Matrix& control, const double error_bound,
    4646              std::ostream* error);
    4848bool test_SEV(const classifier::MatrixLookup& data,
    4949              const classifier::KernelFunction* kf,
    50               const utility::matrix& control, const double error_bound,
     50              const utility::Matrix& control, const double error_bound,
    5151              std::ostream* error);
    6666  bool ok = true;
    68   utility::matrix data2_core(2,3);
     68  utility::Matrix data2_core(2,3);
    6969  data2_core(0,0)=0;
    7070  data2_core(1,0)=0;
    9595  double error_bound = 1e-8;
    9696  std::ifstream is("data/nm_data_centralized.txt");
    97   utility::matrix data_core(is);
     97  utility::Matrix data_core(is);
    9898  is.close();
    103   utility::matrix kernel_matlab(is);
     103  utility::Matrix kernel_matlab(is);
    104104  is.close();
    105105  classifier::KernelFunction* kf = new classifier::PolynomialKernelFunction();
    111   utility::matrix kernel_matlab2(is);
     111  utility::Matrix kernel_matlab2(is);
    112112  is.close();
    113113  kf = new classifier::PolynomialKernelFunction(2);
    119119  *error << "Checking GaussianKernelFunction.\n";
    121   utility::matrix kernel_gaussian(is);
     121  utility::Matrix kernel_gaussian(is);
    122122  is.close();
    123123  kf = new classifier::GaussianKernelFunction(100);
    144144bool test_MEV(const classifier::MatrixLookup& data,
    145145              const classifier::KernelFunction* kf,
    146               const utility::matrix& control, const double error_bound,
     146              const utility::Matrix& control, const double error_bound,
    147147              std::ostream* error)
    182182bool test_SEV(const classifier::MatrixLookup& data,
    183183              const classifier::KernelFunction* kf,
    184               const utility::matrix& control, const double error_bound,
     184              const utility::Matrix& control, const double error_bound,
    185185              std::ostream* error)
  • trunk/test/

    r1112 r1121  
    2828#include "yat/classifier/MatrixLookupWeighted.h"
    2929#include "yat/statistics/EuclideanDistance.h"
    30 #include "yat/utility/matrix.h"
     30#include "yat/utility/Matrix.h"
    4141using namespace theplu::yat;
    43 double deviation(const utility::matrix& a, const utility::matrix& b) {
     43double deviation(const utility::Matrix& a, const utility::Matrix& b) {
    4444  double sl=0;
    4545  for (size_t i=0; i<a.rows(); i++){
    7070  ////////////////////////////////////////////////////////////////
    7171  *error << "test of predictions using unweighted training and test data\n";
    72   utility::matrix data1(3,4);
     72  utility::Matrix data1(3,4);
    7373  for(size_t i=0;i<3;i++) {
    7474    data1(i,0)=3-i;
    8787  knn1.k(3);
    8888  knn1.train();
    89   utility::matrix prediction1;
     89  utility::Matrix prediction1;
    9090  knn1.predict(ml1,prediction1);
    9191  double slack_bound=2e-7;
    92   utility::matrix result1(2,4);
     92  utility::Matrix result1(2,4);
    9393  result1(0,0)=result1(0,1)=result1(1,2)=result1(1,3)=2.0;
    9494  result1(0,2)=result1(0,3)=result1(1,0)=result1(1,1)=1.0;
    106106  ////////////////////////////////////////////////////////////////
    107107  *error << "test of predictions using unweighted training and weighted test data\n";
    108   utility::matrix weights1(3,4,1.0);
     108  utility::Matrix weights1(3,4,1.0);
    109109  weights1(2,0)=0;
    110110  classifier::MatrixLookupWeighted mlw1(data1,weights1);
    125125  *error << "test of predictions using weighted training and test data\n";
    126126  weights1(0,1)=0;
    127   utility::matrix weights2(3,4,1.0);
     127  utility::Matrix weights2(3,4,1.0);
    128128  weights2(2,3)=0;
    129129  classifier::MatrixLookupWeighted mlw2(data1,weights2);
    146146  // A test of reciprocal ranks weighting with training and test both weighted
    147147  ////////////////////////////////////////////////////////////////
    148   utility::matrix data2(data1);
     148  utility::Matrix data2(data1);
    149149  data2(1,3)=7;
    150150  classifier::MatrixLookupWeighted mlw3(data2,weights2);
  • trunk/test/

    r1000 r1121  
    24 #include "yat/utility/matrix.h"
     24#include "yat/utility/Matrix.h"
    2525#include "yat/classifier/MatrixLookup.h"
    3131using namespace theplu::yat;
    33 utility::matrix matrix(size_t n);
     33utility::Matrix matrix(size_t n);
    3535int main(const int argc,const char* argv[])
    4949  *error << "\nTesting MatrixLookup" << std::endl;
    50   *error << "MatrixLookup::MatrixLookup(const utility::matrix& data)...";
    51   utility::matrix gsl_m1(matrix(2));
     50  *error << "MatrixLookup::MatrixLookup(const utility::Matrix& data)...";
     51  utility::Matrix gsl_m1(matrix(2));
    5252  classifier::MatrixLookup m1(gsl_m1);
    5353  if (m1.rows()!=gsl_m1.rows() || m1.columns()!=gsl_m1.columns() ||
    63   *error << "MatrixLookup::MatrixLookup(const utility::matrix&,\n"
     63  *error << "MatrixLookup::MatrixLookup(const utility::Matrix&,\n"
    6464         << "                           const std::vector<size_t>&,\n"
    6565         << "                           const std::vector<size_t>&)...";
    66   utility::matrix gsl_m2(matrix(4));
     66  utility::Matrix gsl_m2(matrix(4));
    6767  std::vector<size_t> index_odd;
    6868  index_odd.push_back(1);
    8282    *error << "Ok" << std::endl;
    84   *error << "MatrixLookup::MatrixLookup(const utility::matrix&,\n"
     84  *error << "MatrixLookup::MatrixLookup(const utility::Matrix&,\n"
    8585         << "                           const std::vector<size_t>&,\n"
    8686         << "                           const bool)...";
    175 utility::matrix matrix(size_t n)
     175utility::Matrix matrix(size_t n)
    177   utility::matrix res(n,n);
     177  utility::Matrix res(n,n);
    178178  for (size_t i=0;i<n;i++)
    179179    for (size_t j=0;j<n;j++)
  • trunk/test/

    r1120 r1121  
    26 #include "yat/utility/matrix.h"
     26#include "yat/utility/Matrix.h"
    2828#include <cstdio>
    3939  row(const size_t& i) { return m_.row_view(i); }
    41   inline const theplu::yat::utility::matrix& matrix(void) const { return m_; }
     41  inline const theplu::yat::utility::Matrix& matrix(void) const { return m_; }
    44   theplu::yat::utility::matrix m_;
     44  theplu::yat::utility::Matrix m_;
    6060  *error << "Testing matrix class" << std::endl;
    6161  bool ok = true;
    62   utility::matrix unit3x3(3,3);
     62  utility::Matrix unit3x3(3,3);
    6363  for (size_t i=0; i<unit3x3.rows(); ++i)
    6464    unit3x3(i,i)=1;
    6666  *error << "\tcopy constructor and operator!=" << std::endl;
    67   utility::matrix m(3,3,9);
    68   utility::matrix m2(m);
     67  utility::Matrix m(3,3,9);
     68  utility::Matrix m2(m);
    6969  if (m2!=m)
    7070    ok=false;
    7777  my_out.close();
    7878  std::ifstream is("data/tmp_test_matrix.txt");
    79   utility::matrix m3(is);
     79  utility::Matrix m3(is);
    8080  is.close();
    8181  if (m3!=m2)
    8585  *error << "\toperator*=(double)" << std::endl;
    86   utility::matrix m4(3,3,1);
     86  utility::Matrix m4(3,3,1);
    8787  m4 *= 9;
    8888  if (m4!=m) {
    9595  // lines and other whitespaces. The file is not expected to break
    9696  // things.
    97   utility::matrix m5(is);
     97  utility::Matrix m5(is);
    9898  is.close();
    9999  double m5_sum=0;
    106106  {
    107107    *error << "\tcopy constructor" << std::endl;
    108     utility::matrix m2(m5);
     108    utility::Matrix m2(m5);
    109109    ok &= (m2.rows()==m5.rows());
    110110    ok &= (m2.columns()==m5.columns());
    202202  *error << "\tmatrix::nan()" << std::endl;
    204   utility::matrix* m_nan = new utility::matrix(is,'\t');
    205   utility::matrix m_weight;
     204  utility::Matrix* m_nan = new utility::Matrix(is,'\t');
     205  utility::Matrix m_weight;
    206206  utility::nan(*m_nan,m_weight);
    207207  is.close();
    220220  *error << "\toperator*=(matrix&)" << std::endl;
    221   utility::matrix m6(unit3x3);
     221  utility::Matrix m6(unit3x3);
    222222  m6 *= m;
    223223  if (m6!=m) {
    230230    *error << "error operator*=(matrix) 2" << std::endl;
    231231  }
    232   m6*= utility::matrix(3,4,1.0);
    233   m6*= utility::matrix(4,3,1.0);
    234   m6*= utility::matrix(3,5,2.0);
    235   m6*= utility::matrix(5,5,2.0);
    236   m6*= utility::matrix(5,3,2.0);
     232  m6*= utility::Matrix(3,4,1.0);
     233  m6*= utility::Matrix(4,3,1.0);
     234  m6*= utility::Matrix(3,5,2.0);
     235  m6*= utility::Matrix(5,5,2.0);
     236  m6*= utility::Matrix(5,3,2.0);
    237237  m6*= unit3x3;
  • trunk/test/

    r1000 r1121  
    2626#include "yat/classifier/NBC.h"
    2727#include "yat/classifier/Target.h"
    28 #include "yat/utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    3030#include <cassert>
    5151  std::ifstream is("data/nm_data_centralized.txt");
    52   utility::matrix data_core(is);
     52  utility::Matrix data_core(is);
    5353  is.close();
    5454  classifier::MatrixLookup data(data_core);
    6262  *error << "Training NBC" << std::endl;
    6363  nbc.train();
    64   utility::matrix res;
     64  utility::Matrix res;
    6565  *error << "Predicting" << std::endl;
    6666  nbc.predict(data, res);
  • trunk/test/

    r1084 r1121  
    3030#include "yat/classifier/PolynomialKernelFunction.h"
    3131#include "yat/classifier/Target.h"
    32 #include "yat/utility/matrix.h"
     32#include "yat/utility/Matrix.h"
    3333#include "yat/statistics/EuclideanDistance.h"
    3434#include "yat/statistics/PearsonDistance.h"
    4646using namespace theplu::yat;
    48 double deviation(const utility::matrix& a, const utility::matrix& b) {
     48double deviation(const utility::Matrix& a, const utility::Matrix& b) {
    4949  double sl=0;
    5050  for (size_t i=0; i<a.rows(); i++){
    8787  /////////////////////////////////////////////
    8888  *error << "test of predictions using unweighted test data\n";
    89   utility::matrix data1(3,4);
     89  utility::Matrix data1(3,4);
    9090  for(size_t i=0;i<3;i++) {
    9191    data1(i,0)=3-i;
    103103  classifier::NCC<statistics::EuclideanDistance> ncc1(ml1,target1);
    104104  ncc1.train();
    105   utility::matrix prediction1;
     105  utility::Matrix prediction1;
    106106  ncc1.predict(ml1,prediction1);
    107107  double slack_bound=2e-7;
    108   utility::matrix result1(2,4);
     108  utility::Matrix result1(2,4);
    109109  result1(0,0)=result1(0,1)=result1(1,2)=result1(1,3)=sqrt(3.0);
    110110  result1(0,2)=result1(0,3)=result1(1,0)=result1(1,1)=sqrt(11.0);
    121121  //////////////////////////////////////////////////////////////////////////
    122122  *error << "test of predictions using unweighted training and weighted test data\n";
    123   utility::matrix weights1(3,4,1.0);
     123  utility::Matrix weights1(3,4,1.0);
    124124  weights1(0,0)=weights1(1,1)=weights1(2,2)=weights1(1,3)=0.0;
    125125  classifier::MatrixLookupWeighted mlw1(data1,weights1);
    139139  //////////////////////////////////////////////////////////////////////////
    140140  *error << "test of predictions using nan centroids and unweighted test data\n";
    141   utility::matrix weights2(3,4,1.0);
     141  utility::Matrix weights2(3,4,1.0);
    142142  weights2(1,0)=weights2(1,1)=0.0;
    143143  classifier::MatrixLookupWeighted mlw2(data1,weights2);
    163163  *error << "test with Sorlie data\n";
    164164  std::ifstream is("data/sorlie_centroid_data.txt");
    165   utility::matrix data(is,'\t');
     165  utility::Matrix data(is,'\t');
    166166  is.close();
    172172  // Generate weight matrix with 0 for missing values and 1 for others.
    173   utility::matrix weights(data.rows(),data.columns(),0.0);
     173  utility::Matrix weights(data.rows(),data.columns(),0.0);
    174174  utility::nan(data,weights);
    181181  // Comparing the centroids to stored result
    183   utility::matrix centroids(is);
     183  utility::Matrix centroids(is);
    184184  is.close();
    203203  *error << "...predicting...\n";
    204   utility::matrix prediction;
     204  utility::Matrix prediction;
    205205  ncc.predict(dataviewweighted,prediction);
    207207  // Comparing the prediction to stored result
    209   utility::matrix result(is,'\t');
     209  utility::Matrix result(is,'\t');
    210210  is.close();
  • trunk/test/

    r1000 r1121  
    2626#include "yat/utility/FileUtil.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/kNNI.h"
    2929#include "yat/utility/WeNNI.h"
    6565  std::ifstream data_stream(knni_data.c_str());
    6666  std::ifstream weight_stream(knni_weight.c_str());
    67   utility::matrix data(data_stream);
    68   utility::matrix weight(weight_stream);
     67  utility::Matrix data(data_stream);
     68  utility::Matrix weight(weight_stream);
    6969  utility::kNNI knni(data,weight,neighbours);
    7070  knni.estimate();
    7171  std::ifstream control_stream(knni_result.c_str());
    72   utility::matrix control(control_stream);
     72  utility::Matrix control(control_stream);
    7373  control-=knni.imputed_data();
    7474  double error_bound = 5e-13;
    9696  // test WeNNI
    98   data=utility::matrix(data_stream);
     98  data=utility::Matrix(data_stream);
    100   weight=utility::matrix(weight_stream);
     100  weight=utility::Matrix(weight_stream);
    101101  utility::WeNNI wenni(data,weight,neighbours);
    102102  wenni.estimate();
    104   control=utility::matrix(control_stream);
     104  control=utility::Matrix(control_stream);
    105105  control-=wenni.imputed_data();
    106106  for (unsigned int i=0; i<control.rows(); i++)
    127127  // test WeNNI with binary weights
    129   data=utility::matrix(data_stream);
     129  data=utility::Matrix(data_stream);
    131   weight=utility::matrix(weight_stream);
     131  weight=utility::Matrix(weight_stream);
    132132  utility::WeNNI wenni2(data,weight,neighbours);
    133133  wenni2.estimate();
    135   control=utility::matrix(control_stream);
     135  control=utility::Matrix(control_stream);
    136136  control-=wenni2.imputed_data();
    137137  for (unsigned int i=0; i<control.rows(); i++)
  • trunk/test/

    r1098 r1121  
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/PCA.h"
    3838  using namespace theplu::yat;
    39   utility::matrix A( 3, 4 );
     39  utility::Matrix A( 3, 4 );
    4040  for( size_t i = 0; i < 3; ++i )
    4141    for( size_t j = 0; j < 4; ++j )
  • trunk/test/

    r1120 r1121  
    3030#include "yat/regression/Polynomial.h"
    3131#include "yat/regression/PolynomialWeighted.h"
    32 #include "yat/utility/matrix.h"
     32#include "yat/utility/Matrix.h"
    3333#include "yat/utility/Vector.h"
    207207  {
    208208    std::ifstream s("data/");
    209     utility::matrix data(s);
     209    utility::Matrix data(s);
    210210    utility::Vector x(data.rows());
    211211    utility::Vector ln_y(data.rows());
    416416  utility::Vector w(5,1.0);
    418   utility::matrix data(5,3);
     418  utility::Matrix data(5,3);
    419419  for (size_t i=0; i<data.rows(); ++i){
    420420    data(i,0)=1;
  • trunk/test/

    r1120 r1121  
    2626#include "yat/statistics/ROC.h"
    2727#include "yat/statistics/utility.h"
    28 #include "yat/utility/matrix.h"
    2928#include "yat/utility/Vector.h"
  • trunk/test/

    r1120 r1121  
    3030#include "yat/statistics/tScore.h"
    3131#include "yat/statistics/WilcoxonFoldChange.h"
    32 #include "yat/utility/matrix.h"
     32#include "yat/utility/Matrix.h"
    3333#include "yat/utility/Vector.h"
    3434#include "yat/utility/VectorView.h"
    8080  std::ifstream is("data/rank_data.txt");
    81   utility::matrix data(is);
     81  utility::Matrix data(is);
    8282  is.close();
  • trunk/test/

    r1045 r1121  
    2424#include "yat/utility/SmartPtr.h"
    25 #include "yat/utility/matrix.h"
     25#include "yat/utility/Matrix.h"
    2727#include <fstream>
    4545  bool ok = true;
    47   utility::SmartPtr<utility::matrix> m(new utility::matrix(10,10));
     47  utility::SmartPtr<utility::Matrix> m(new utility::Matrix(10,10));
    4848  if (m->columns()==10){
    49     utility::SmartPtr<utility::matrix> m2(m);
     49    utility::SmartPtr<utility::Matrix> m2(m);
    5050    m2 = m;
    5151  }
    5555  m = m;
    56   utility::matrix m2 = *m;
     56  utility::Matrix m2 = *m;
    5858  if (m->columns()!=10)
  • trunk/test/

    r1086 r1121  
    3434#include "yat/classifier/NCC.h"
    3535#include "yat/statistics/AUC.h"
    36 #include "yat/utility/matrix.h"
     36#include "yat/utility/Matrix.h"
    3838#include <cassert>
    8686  *error << "loading data " << std::endl;
    87   utility::matrix m(is);
     87  utility::Matrix m(is);
    8888  is.close();
    8989  classifier::MatrixLookup data(m);
    124124  classifier::Target target(label);
    125   utility::matrix raw_data2(2,9);
     125  utility::Matrix raw_data2(2,9);
    126126  for(size_t i=0;i<raw_data2.rows();i++)
    127127    for(size_t j=0;j<raw_data2.columns();j++)
    305305  classifier::Target target(label);
    306   utility::matrix raw_data(10,10);
     306  utility::Matrix raw_data(10,10);
    307307  classifier::MatrixLookup data(raw_data);
    308308  classifier::BootstrapSampler cv(target,3);
    322322  classifier::Target target(label);
    323   utility::matrix raw_data(10,10);
     323  utility::Matrix raw_data(10,10);
    324324  classifier::MatrixLookup data(raw_data);
    325325  classifier::CrossValidationSampler cv(target,3,3);
  • trunk/test/

    r1120 r1121  
    2727#include "yat/random/random.h"
    28 #include "yat/utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    2929#include "yat/utility/SVD.h"
    3030#include "yat/utility/Vector.h"
    3232using namespace theplu::yat;
    34 double this_norm(const utility::matrix& A)
     34double this_norm(const utility::Matrix& A)
    3636  double sum=0.0;
    4949  // initialise a random test-matrix
    5050  theplu::yat::random::ContinuousUniform rnd;
    51   utility::matrix A(m,n);
     51  utility::Matrix A(m,n);
    5252  for (size_t i=0; i<m; ++i)
    5353    for(size_t j=0; j<n; ++j)
    5757  svd.decompose(algo);
    5858  theplu::yat::utility::Vector s(svd.s());
    59   utility::matrix S(s.size(),s.size());
     59  utility::Matrix S(s.size(),s.size());
    6060  for (size_t i=0; i<s.size(); ++i)
    6161    S(i,i)=s[i];
    62   utility::matrix Vtranspose=svd.V();
     62  utility::Matrix Vtranspose=svd.V();
    6363  Vtranspose.transpose();
    6464  // Reconstructing A = U*S*Vtranspose
    65   utility::matrix Areconstruct(svd.U());
     65  utility::Matrix Areconstruct(svd.U());
    6666  Areconstruct*=S;
    6767  Areconstruct*=Vtranspose;
    8686  }
    88   utility::matrix Utranspose(svd.U());
     88  utility::Matrix Utranspose(svd.U());
    8989  Utranspose.transpose();
    9090  Utranspose*=svd.U();  // Expect unity matrix
  • trunk/test/

    r1120 r1121  
    3131#include "yat/classifier/PolynomialKernelFunction.h"
    3232#include "yat/classifier/Target.h"
    33 #include "yat/utility/matrix.h"
     33#include "yat/utility/Matrix.h"
    3434#include "yat/utility/Vector.h"
    5656  bool ok = true;
    58   utility::matrix data2_core(2,3);
     58  utility::Matrix data2_core(2,3);
    5959  data2_core(0,0)=0;
    6060  data2_core(1,0)=0;
    113113  std::ifstream is("data/nm_data_centralized.txt");
    114   utility::matrix data_core(is);
     114  utility::Matrix data_core(is);
    115115  is.close();
  • trunk/test/

    r1119 r1121  
    24 #include "yat/utility/matrix.h"
     24#include "yat/utility/Matrix.h"
    2525#include "yat/utility/VectorBase.h"
    2626#include "yat/utility/VectorMutable.h"
    4646  bool ok = true;
    48   matrix data1;
     48  Matrix data1;
    4949  data1.resize(3,1);
    5050  for(size_t i=0;i<3;i++) {
    5252  }
    54   matrix data2(3,1,1.0);
     54  Matrix data2(3,1,1.0);
    5656  VectorConstView a=data1.column_const_view(0);
  • trunk/yat/classifier/

    r1120 r1121  
    2828#include "MatrixLookup.h"
    30 #include "yat/utility/matrix.h"
     30#include "yat/utility/Matrix.h"
    3131#include "yat/utility/Vector.h"
    6666    : column_vector_(true), index_(0), owner_(true)
    6767  {
    68     utility::matrix* m = new utility::matrix(1,index.size());
     68    utility::Matrix* m = new utility::Matrix(1,index.size());
    6969    for (size_t i=0; i<index.size(); ++i){
    7070      assert(index[i]<v.size());
    7878    : column_vector_(false), index_(0), owner_(true)
    7979  {
    80     utility::matrix* m = new utility::matrix(1,v.size());
     80    utility::Matrix* m = new utility::Matrix(1,v.size());
    8181    for (size_t i=0; i<v.size(); ++i){
    8282      (*m)(0,i)=v(i);
  • trunk/yat/classifier/EnsembleBuilder.h

    r1088 r1121  
    3131#include "SubsetGenerator.h"
    3232#include "yat/statistics/Averager.h"
     33#include "yat/utility/Matrix.h"
    3435#include <vector>
    177178      result.push_back(std::vector<statistics::Averager>(data.columns()));
    179     utility::matrix prediction; 
     180    utility::Matrix prediction; 
    181182    for(u_long k=0;k<subset_->size();++k) {       
    203204      validation_result_.push_back(std::vector<statistics::Averager>(subset_->target().size()));
    205     utility::matrix prediction; 
     206    utility::Matrix prediction; 
    206207    for(u_long k=0;k<subset_->size();k++) {
    207208      classifier(k).predict(subset_->validation_data(k),prediction);
  • trunk/yat/classifier/KNN.h

    r1115 r1121  
    3232#include "SupervisedClassifier.h"
    3333#include "Target.h"
    34 #include "yat/utility/matrix.h"
     34#include "yat/utility/Matrix.h"
    3535#include "yat/utility/yat_assert.h"
    107107    ///
    108108    ///
    109     void predict(const DataLookup2D&, utility::matrix&) const;
     109    void predict(const DataLookup2D&, utility::Matrix&) const;
    129129    /// generated and needs to be deleted by the caller.
    130130    ///
    131     utility::matrix* calculate_distances(const DataLookup2D&) const;
     131    utility::Matrix* calculate_distances(const DataLookup2D&) const;
    133133    void calculate_unweighted(const MatrixLookup&,
    134134                              const MatrixLookup&,
    135                               utility::matrix*) const;
     135                              utility::Matrix*) const;
    136136    void calculate_weighted(const MatrixLookupWeighted&,
    137137                            const MatrixLookupWeighted&,
    138                             utility::matrix*) const;
     138                            utility::Matrix*) const;
    139139  };
    163163  template <typename Distance, typename NeighborWeighting>
    164   utility::matrix* KNN<Distance, NeighborWeighting>::calculate_distances
     164  utility::Matrix* KNN<Distance, NeighborWeighting>::calculate_distances
    165165  (const DataLookup2D& test) const
    166166  {
    167167    // matrix with training samples as rows and test samples as columns
    168     utility::matrix* distances =
    169       new utility::matrix(data_.columns(),test.columns());
     168    utility::Matrix* distances =
     169      new utility::Matrix(data_.columns(),test.columns());
    210210  void  KNN<Distance, NeighborWeighting>::calculate_unweighted
    211211  (const MatrixLookup& training, const MatrixLookup& test,
    212    utility::matrix* distances) const
     212   utility::Matrix* distances) const
    213213  {
    214214    for(size_t i=0; i<training.columns(); i++) {
    226226  KNN<Distance, NeighborWeighting>::calculate_weighted
    227227  (const MatrixLookupWeighted& training, const MatrixLookupWeighted& test,
    228    utility::matrix* distances) const
     228   utility::Matrix* distances) const
    229229  {
    230230    for(size_t i=0; i<training.columns(); i++) {
    295295  template <typename Distance, typename NeighborWeighting>
    296296  void KNN<Distance, NeighborWeighting>::predict(const DataLookup2D& test,
    297                                                  utility::matrix& prediction) const
     297                                                 utility::Matrix& prediction) const
    298298  {   
    299299    utility::yat_assert<std::runtime_error>(data_.rows()==test.rows());
    301     utility::matrix* distances=calculate_distances(test);
     301    utility::Matrix* distances=calculate_distances(test);
    303303    prediction.resize(target_.nof_classes(),test.columns(),0.0);
  • trunk/yat/classifier/

    r1105 r1121  
    2626#include "MatrixLookup.h"
    2727#include "MatrixLookupWeighted.h"
    28 #include "../utility/matrix.h"
     28#include "yat/utility/Matrix.h"
    3030#include <cassert>
    205205    assert(data.rows()==kernel_->data().rows());
    206206    if (!weighted()){
    207       utility::matrix* data_all =
    208         new utility::matrix(data.rows(), row_index_.size()+data.columns());
     207      utility::Matrix* data_all =
     208        new utility::Matrix(data.rows(), row_index_.size()+data.columns());
    210210      for (size_t i=0; i<data_all->rows(); ++i) {
    240240    // kernel_ holds MatrixLookupWeighted, hence new Kernel also
    241241    // should hold a MatrixLookupweighted.
    242     utility::matrix* data_all =
    243       new utility::matrix(data.rows(), rows()+data.columns());
    244     utility::matrix* weight_all =
    245       new utility::matrix(data.rows(), rows()+data.columns(), 1.0);
     242    utility::Matrix* data_all =
     243      new utility::Matrix(data.rows(), rows()+data.columns());
     244    utility::Matrix* weight_all =
     245      new utility::Matrix(data.rows(), rows()+data.columns(), 1.0);
    246246    const MatrixLookupWeighted& kernel_data =
    247247      dynamic_cast<const MatrixLookupWeighted&>(kernel_->data());
    281281  KernelLookup::test_kernel(const MatrixLookupWeighted& data) const
    282282  {
    283     utility::matrix* data_all =
    284       new utility::matrix(data.rows(), rows()+data.columns());
    285     utility::matrix* weight_all =
    286       new utility::matrix(data.rows(), rows()+data.columns(), 1.0);
     283    utility::Matrix* data_all =
     284      new utility::Matrix(data.rows(), rows()+data.columns());
     285    utility::Matrix* weight_all =
     286      new utility::Matrix(data.rows(), rows()+data.columns(), 1.0);
    288288    if (weighted()){
  • trunk/yat/classifier/

    r1098 r1121  
    2828#include "KernelFunction.h"
    2929#include "MatrixLookup.h"
    30 #include "yat/utility/matrix.h"
     30#include "yat/utility/Matrix.h"
    3232namespace theplu {
  • trunk/yat/classifier/Kernel_SEV.h

    r1000 r1121  
    2929#include "Kernel.h"
    30 #include "yat/utility/matrix.h"
     30#include "yat/utility/Matrix.h"
    3232namespace theplu {
    113113    void build_kernel(void);
    115     utility::matrix kernel_matrix_;
     115    utility::Matrix kernel_matrix_;
    117117  }; // class Kernel_SEV
  • trunk/yat/classifier/

    r1105 r1121  
    2626#include "MatrixLookup.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2929#include <algorithm>
    3535namespace classifier {
    37   MatrixLookup::MatrixLookup(const utility::matrix& data, const bool own)
     37  MatrixLookup::MatrixLookup(const utility::Matrix& data, const bool own)
    3838    : DataLookup2D(own), data_(&data)
    3939  {
    50   MatrixLookup::MatrixLookup(const utility::matrix& data,
     50  MatrixLookup::MatrixLookup(const utility::Matrix& data,
    5151                             const std::vector<size_t>& row,
    5252                             const std::vector<size_t>& col)
    65   MatrixLookup::MatrixLookup(const utility::matrix& data,
     65  MatrixLookup::MatrixLookup(const utility::Matrix& data,
    6666                             const std::vector<size_t>& index,
    6767                             const bool row)
    136136    : DataLookup2D(rows,columns)
    137137  {
    138     data_ = new utility::matrix(1,1,value);
     138    data_ = new utility::Matrix(1,1,value);
    139139    ref_count_= new u_int(1);
    140140  }
    144144    : DataLookup2D()
    145145  {
    146     data_ = new utility::matrix(is,sep);
     146    data_ = new utility::Matrix(is,sep);
    147147    ref_count_= new u_int(1);
    148148    for(size_t i=0;i<(*data_).rows();i++)
  • trunk/yat/classifier/MatrixLookup.h

    r1110 r1121  
    4040namespace utility {
    41   class matrix;
     41  class Matrix;
    9696    /// undefined.
    9797    ///
    98     MatrixLookup(const utility::matrix& matrix, const bool own=false);
     98    MatrixLookup(const utility::Matrix& matrix, const bool own=false);
    100100    ///
    111111    /// undefined.
    112112    ///
    113     MatrixLookup(const utility::matrix& matrix, const std::vector<size_t>& row,
     113    MatrixLookup(const utility::Matrix& matrix, const std::vector<size_t>& row,
    114114                 const std::vector<size_t>& column);
    131131    /// undefined.
    132132    ///
    133     MatrixLookup(const utility::matrix& matrix,
     133    MatrixLookup(const utility::Matrix& matrix,
    134134                 const std::vector<size_t>& index,
    135135                 const bool row_vectors);
    330330    friend class MatrixLookupWeighted;
    332     const utility::matrix* data_;
     332    const utility::Matrix* data_;
    333333  }; 
  • trunk/yat/classifier/

    r1105 r1121  
    2525#include "MatrixLookupWeighted.h"
    2626#include "MatrixLookup.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2929#include <algorithm>
    3535namespace classifier {
    37   MatrixLookupWeighted::MatrixLookupWeighted(const utility::matrix& data,
    38                                              const utility::matrix& weights,
     37  MatrixLookupWeighted::MatrixLookupWeighted(const utility::Matrix& data,
     38                                             const utility::Matrix& weights,
    3939                                             const bool own)
    4040    : DataLookup2D(own), data_(&data), weights_(&weights),
    52   MatrixLookupWeighted::MatrixLookupWeighted(const utility::matrix& data)
     52  MatrixLookupWeighted::MatrixLookupWeighted(const utility::Matrix& data)
    5353    : DataLookup2D(), data_(&data)
    5454  {
    55     utility::matrix weights;
     55    utility::Matrix weights;
    5656    utility::nan(*data_,weights);
    57     weights_= new utility::matrix(weights);
     57    weights_= new utility::Matrix(weights);
    5858    ref_count_weights_=new u_int(1);
    5959    for(size_t i=0;i<(*data_).rows();i++)
    6767    : DataLookup2D(ml), data_(ml.data_)
    6868  {
    69     weights_= new utility::matrix(data_->rows(), data_->columns(), 1.0);
     69    weights_= new utility::Matrix(data_->rows(), data_->columns(), 1.0);
    7070    ref_count_weights_=new u_int(1);
    7171    ref_count_=ml.ref_count_;
    78   MatrixLookupWeighted::MatrixLookupWeighted(const utility::matrix& data,
    79                                              const utility::matrix& weights,
     78  MatrixLookupWeighted::MatrixLookupWeighted(const utility::Matrix& data,
     79                                             const utility::Matrix& weights,
    8080                                             const std::vector<size_t>& row,
    8181                                             const std::vector<size_t>& col)
    101   MatrixLookupWeighted::MatrixLookupWeighted(const utility::matrix& data,
    102                                              const utility::matrix& weights,
     101  MatrixLookupWeighted::MatrixLookupWeighted(const utility::Matrix& data,
     102                                             const utility::Matrix& weights,
    103103                                             const std::vector<size_t>& index,
    104104                                             const bool row)
    209209    : DataLookup2D(rows,columns)
    210210  {
    211     data_ = new utility::matrix(1,1,value);
     211    data_ = new utility::Matrix(1,1,value);
    212212    ref_count_=new u_int(1);
    213     weights_ = new utility::matrix(1,1,weight);
     213    weights_ = new utility::Matrix(1,1,weight);
    214214    ref_count_weights_=new u_int(1);
    215215  }
    219219    : DataLookup2D()
    220220  {
    221     data_ = new utility::matrix(is,sep);
     221    data_ = new utility::Matrix(is,sep);
    222222    ref_count_=new u_int(1);
    223223    for(size_t i=0;i<(*data_).rows();i++)
    225225    for(size_t i=0;i<(*data_).columns();i++)
    226226      column_index_.push_back(i);
    227     utility::matrix weights;
     227    utility::Matrix weights;
    228228    utility::nan(*data_,weights);
    229     weights_= new utility::matrix(weights);
     229    weights_= new utility::Matrix(weights);
    230230    ref_count_weights_=new u_int(1);
    231231  }
  • trunk/yat/classifier/MatrixLookupWeighted.h

    r1110 r1121  
    4040namespace utility {
    41   class matrix;
     41  class Matrix;
    9191    /// result of further use is undefined.
    9292    ///
    93     MatrixLookupWeighted(const utility::matrix& matrix,
    94                          const utility::matrix& weights,
     93    MatrixLookupWeighted(const utility::Matrix& matrix,
     94                         const utility::Matrix& weights,
    9595                         const bool owner=false);
    107107    /// result of further use is undefined.
    108108    ///
    109     MatrixLookupWeighted(const utility::matrix& matrix);
     109    MatrixLookupWeighted(const utility::Matrix& matrix);
    140140    /// undefined.
    141141    ///
    142     MatrixLookupWeighted(const utility::matrix& matrix,
    143                          const utility::matrix& weights,
     142    MatrixLookupWeighted(const utility::Matrix& matrix,
     143                         const utility::Matrix& weights,
    144144                         const std::vector<size_t>& row,
    145145                         const std::vector<size_t>& column);
    163163    /// result of further use is undefined.
    164164    ///
    165     MatrixLookupWeighted(const utility::matrix& matrix,
    166                          const utility::matrix& weights,
     165    MatrixLookupWeighted(const utility::Matrix& matrix,
     166                         const utility::Matrix& weights,
    167167                         const std::vector<size_t>& index,
    168168                         const bool row_vectors);
    369369  private:
    370     const utility::matrix* data_;
    371     const utility::matrix* weights_;
     370    const utility::Matrix* data_;
     371    const utility::Matrix* weights_;
    372372    u_int* ref_count_weights_;
    373373  }; 
  • trunk/yat/classifier/

    r1120 r1121  
    2929#include "Target.h"
    3030#include "yat/statistics/AveragerWeighted.h"
    31 #include "yat/utility/matrix.h"
     31#include "yat/utility/Matrix.h"
    3333#include <cassert>
    8686    sigma2_.resize(data_.rows(), target_.nof_classes());
    8787    centroids_.resize(data_.rows(), target_.nof_classes());
    88     utility::matrix nof_in_class(data_.rows(), target_.nof_classes());
     88    utility::Matrix nof_in_class(data_.rows(), target_.nof_classes());
    9090    // unweighted
    145145  void NBC::predict(const DataLookup2D& x,                   
    146                     utility::matrix& prediction) const
     146                    utility::Matrix& prediction) const
    147147  {   
    148148    assert(data_.rows()==x.rows());
  • trunk/yat/classifier/NBC.h

    r1042 r1121  
    2828#include "SupervisedClassifier.h"
    29 #include "yat/utility/matrix.h"
     29#include "yat/utility/Matrix.h"
    3131namespace theplu {
    9999       using all weight equal to unity.
    100100    */
    101     void predict(const DataLookup2D& data, utility::matrix& res) const;
     101    void predict(const DataLookup2D& data, utility::Matrix& res) const;
    104104  private:
    105     utility::matrix centroids_;
    106     utility::matrix sigma2_;
     105    utility::Matrix centroids_;
     106    utility::Matrix sigma2_;
    107107    const DataLookup2D& data_;
  • trunk/yat/classifier/NCC.h

    r1120 r1121  
    3737#include "yat/statistics/Averager.h"
    3838#include "yat/statistics/AveragerWeighted.h"
    39 #include "yat/utility/matrix.h"
     39#include "yat/utility/Matrix.h"
    4040#include "yat/utility/Vector.h"
    4141#include "yat/utility/stl_utility.h"
    8181    /// @return the centroids for each class as columns in a matrix.
    8282    ///
    83     const utility::matrix& centroids(void) const;
     83    const utility::Matrix& centroids(void) const;
    8585    const DataLookup2D& data(void) const;
    100100    /// Calculate the distance to each centroid for test samples
    101101    ///
    102     void predict(const DataLookup2D&, utility::matrix&) const;
     102    void predict(const DataLookup2D&, utility::Matrix&) const;
    105105  private:
    107     void predict_unweighted(const MatrixLookup&, utility::matrix&) const;
    108     void predict_weighted(const MatrixLookupWeighted&, utility::matrix&) const;   
    110     utility::matrix* centroids_;
     107    void predict_unweighted(const MatrixLookup&, utility::Matrix&) const;
     108    void predict_weighted(const MatrixLookupWeighted&, utility::Matrix&) const;   
     110    utility::Matrix* centroids_;
    111111    bool centroids_nan_;
    112112    Distance distance_;
    146146  template <typename Distance>
    147   const utility::matrix& NCC<Distance>::centroids(void) const
     147  const utility::Matrix& NCC<Distance>::centroids(void) const
    148148  {
    149149    return *centroids_;
    185185    if(centroids_)
    186186      delete centroids_;
    187     centroids_= new utility::matrix(data_.rows(), target_.nof_classes());
     187    centroids_= new utility::Matrix(data_.rows(), target_.nof_classes());
    188188    // data_ is a MatrixLookup or a MatrixLookupWeighted
    189189    if(data_.weighted()) {
    226226  template <typename Distance>
    227227  void NCC<Distance>::predict(const DataLookup2D& test,                     
    228                               utility::matrix& prediction) const
     228                              utility::Matrix& prediction) const
    229229  {   
    230230    utility::yat_assert<std::runtime_error>
    262262  template <typename Distance>
    263263  void NCC<Distance>::predict_unweighted(const MatrixLookup& test,
    264                                          utility::matrix& prediction) const
     264                                         utility::Matrix& prediction) const
    265265  {
    266266    MatrixLookup unweighted_centroids(*centroids_);
    277277  template <typename Distance>
    278278  void NCC<Distance>::predict_weighted(const MatrixLookupWeighted& test,
    279                                           utility::matrix& prediction) const
     279                                          utility::Matrix& prediction) const
    280280  {
    281281    MatrixLookupWeighted weighted_centroids(*centroids_);
  • trunk/yat/classifier/

    r1120 r1121  
    2929#include "yat/random/random.h"
    3030#include "yat/statistics/Averager.h"
    31 #include "yat/utility/matrix.h"
     31#include "yat/utility/Matrix.h"
    3232#include "yat/utility/Vector.h"
    139139  }
    141   void SVM::predict(const KernelLookup& input, utility::matrix& prediction) const
     141  void SVM::predict(const KernelLookup& input, utility::Matrix& prediction) const
    142142  {
    143143    assert(input.rows()==alpha_.size());
  • trunk/yat/classifier/SVM.h

    r1120 r1121  
    3636namespace theplu {
    3737namespace yat {
     38namespace utility{
     39  class Matrix;
    3842namespace classifier { 
    133137       for training.
    134138    */
    135     void predict(const KernelLookup& input, utility::matrix& predict) const;
     139    void predict(const KernelLookup& input, utility::Matrix& predict) const;
    137141    ///
  • trunk/yat/classifier/

    r1120 r1121  
    2626#include "yat/random/random.h"
    2727#include "yat/statistics/Averager.h"
    28 #include "yat/utility/matrix.h"
    2928#include "yat/utility/Vector.h"
  • trunk/yat/classifier/SupervisedClassifier.h

    r1042 r1121  
    3434  namespace utility {
    35     class matrix;
     35    class Matrix;
    3636  }
    8282    /// Generate output values for a data set
    8383    ///
    84     virtual void predict(const DataLookup2D&, utility::matrix&) const =0;   
     84    virtual void predict(const DataLookup2D&, utility::Matrix&) const =0;   
  • trunk/yat/regression/

    r1120 r1121  
    2525#include "MultiDimensional.h"
    2626#include "yat/utility/Exception.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/VectorBase.h"
    2929#include "yat/utility/Vector.h"
    51   const utility::matrix& MultiDimensional::covariance(void) const
     51  const utility::Matrix& MultiDimensional::covariance(void) const
    5252  {
    5353    return covariance_;
    57   void MultiDimensional::fit(const utility::matrix& x,
     57  void MultiDimensional::fit(const utility::Matrix& x,
    5858                             const utility::VectorBase& y)
    5959  {
  • trunk/yat/regression/MultiDimensional.h

    r1120 r1121  
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/VectorBase.h"
    5454    /// @brief covariance of parameters
    5555    ///
    56     const utility::matrix& covariance(void) const;
     56    const utility::Matrix& covariance(void) const;
    5858    /**
    6464       dimension errors).
    6565    */
    66     void fit(const utility::matrix& X, const utility::VectorBase& y);
     66    void fit(const utility::Matrix& X, const utility::VectorBase& y);
    6868    ///
    9595    double chisquare_;
    9696    double s2_;
    97     utility::matrix covariance_;
     97    utility::Matrix covariance_;
    9898    utility::Vector fit_parameters_;
    9999    gsl_multifit_linear_workspace* work_;
  • trunk/yat/regression/

    r1120 r1121  
    2424#include "MultiDimensionalWeighted.h"
    2525#include "yat/statistics/AveragerWeighted.h"
    26 #include "yat/utility/matrix.h"
     26#include "yat/utility/Matrix.h"
    2727#include "yat/utility/Vector.h"
    53   void MultiDimensionalWeighted::fit(const utility::matrix& x,
     53  void MultiDimensionalWeighted::fit(const utility::Matrix& x,
    5454                                     const utility::VectorBase& y,
    5555                                     const utility::VectorBase& w)
  • trunk/yat/regression/MultiDimensionalWeighted.h

    r1120 r1121  
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/Vector.h"
    6363       dimension errors).
    6464    */
    65     void fit(const utility::matrix& X, const utility::VectorBase& y,
     65    void fit(const utility::Matrix& X, const utility::VectorBase& y,
    6666             const utility::VectorBase& w);
    9494  private:
    9595    double chisquare_;
    96     utility::matrix covariance_;
     96    utility::Matrix covariance_;
    9797    utility::Vector fit_parameters_;
    9898    double s2_;
  • trunk/yat/regression/

    r1120 r1121  
    2626#include "Polynomial.h"
    27 #include "yat/utility/matrix.h"
     27#include "yat/utility/Matrix.h"
    2828#include "yat/utility/VectorBase.h"
    45   const utility::matrix& Polynomial::covariance(void) const
     45  const utility::Matrix& Polynomial::covariance(void) const
    4646  {
    4747    return md_.covariance();
    5353  {
    5454    add(ap_, x.begin(), x.end(), y.begin());
    55     utility::matrix X=utility::matrix(x.size(),power_+1,1);
     55    utility::Matrix X=utility::Matrix(x.size(),power_+1,1);
    5656    for (size_t i=0; i<X.rows(); ++i)
    5757      for (u_int j=1; j<X.columns(); j++)
  • trunk/yat/regression/Polynomial.h

    r1120 r1121  
    5959    /// @brief covariance of parameters
    6060    ///
    61     const utility::matrix& covariance(void) const;
     61    const utility::Matrix& covariance(void) const;
    6363    ///
  • trunk/yat/regression/

    r1120 r1121  
    2525#include "PolynomialWeighted.h"
    26 #include "yat/utility/matrix.h"
     26#include "yat/utility/Matrix.h"
    2727#include "yat/utility/Vector.h"
    5454    utility::Vector dummy(x.size(), 1.0);
    5555    add(ap_,x.begin(), x.end(),y.begin(),dummy.begin(),w.begin());
    56     utility::matrix X=utility::matrix(x.size(),power_+1,1);
     56    utility::Matrix X=utility::Matrix(x.size(),power_+1,1);
    5757    for (size_t i=0; i<X.rows(); ++i)
    5858      for (u_int j=1; j<X.columns(); j++)
  • trunk/yat/utility/

    r1120 r1121  
    2626#include "Alignment.h"
    27 #include "matrix.h"
     27#include "Matrix.h"
    2828#include "stl_utility.h"
    3636namespace utility {
    38   double NeedlemanWunsch(const utility::matrix& s,
     38  double NeedlemanWunsch(const utility::Matrix& s,
    3939                         std::vector<std::pair<size_t, size_t> >& path,
    4040                         const double gap)
    4141  {
    42     utility::matrix m(s.rows()+1,s.columns()+1);
     42    utility::Matrix m(s.rows()+1,s.columns()+1);
    4343    // Init upper and left border of matrix
    4444    for (size_t i=1; i<m.rows(); i++)
    4848    // choice(i,j) tells us how we came to s(i,j). 1 is diagonal, 2
    4949    // vertical, and 3 horizontal,
    50     utility::matrix choice(m.rows(),m.columns());
     50    utility::Matrix choice(m.rows(),m.columns());
    5252    // Calculating NeedlemanWunsch matrix
    9090                 double open_gap)
    9191  {
    92     matrix m(first.size(), second.size());
     92    Matrix m(first.size(), second.size());
    9393    for (size_t i=0; i<first.size(); ++i)
    9494      for (size_t j=0; j<second.size(); ++j)
    100   double SmithWaterman(const utility::matrix& s,
     100  double SmithWaterman(const utility::Matrix& s,
    101101                       double gap, double open_gap)
    102102  {
    105105    // Calculating S-W matrix
    106     matrix m(s.rows()+1,s.columns()+1);
    107     matrix array(m);
     106    Matrix m(s.rows()+1,s.columns()+1);
     107    Matrix array(m);
    108108    for (size_t i=1; i<m.rows(); ++i)
    109109      for (size_t j=1; j<m.columns(); ++j){
  • trunk/yat/utility/Alignment.h

    r1000 r1121  
    3535namespace utility {
    37   class matrix;
     37  class Matrix;
    3939  ///
    5757  /// @return the global maximum alignment score.
    5858  ///
    59   double NeedlemanWunsch(const utility::matrix& s,
     59  double NeedlemanWunsch(const utility::Matrix& s,
    6060                         std::vector<std::pair<size_t, size_t> >& path,
    6161                         const double gap);
    7878     gap of length \f$l\f$ the total cost is \f$open_gap + l*gap\f$.
    7979   */
    80   double SmithWaterman(const utility::matrix& s,
     80  double SmithWaterman(const utility::Matrix& s,
    8181                       double gap, double open_gap);
  • trunk/yat/utility/

    r1120 r1121  
    2727libutility_la_SOURCES = \
    2828 \
    29 \
     29 \
    3030 \
    3131 \
    3838  Container2DIterator.h \
    3939  Exception.h FileUtil.h Index.h IteratorPolicy.h iterator_traits.h \
    40   kNNI.h matrix.h NNI.h \
     40  kNNI.h Matrix.h NNI.h \
    4141  Option.h OptionArg.h OptionFile.h OptionInFile.h OptionOutFile.h \
    4242  OptionHelp.h OptionSwitch.h \
  • trunk/yat/utility/

    r1120 r1121  
    27 #include "yat/utility/matrix.h"
    28 #include "yat/utility/Vector.h"
     27#include "Matrix.h"
     28#include "Vector.h"
    2929#include "VectorBase.h"
    3030#include "VectorConstView.h"
    46   matrix::matrix(void)
     46  Matrix::Matrix(void)
    4747    : blas_result_(NULL), m_(NULL)
    4848  {
    52   matrix::matrix(const size_t& r, const size_t& c, double init_value)
     52  Matrix::Matrix(const size_t& r, const size_t& c, double init_value)
    5353    : blas_result_(NULL), m_(gsl_matrix_alloc(r,c))
    5454  {
    5555    if (!m_)
    56       throw utility::GSL_error("matrix::matrix failed to allocate memory");
     56      throw utility::GSL_error("Matrix::Matrix failed to allocate memory");
    5757    all(init_value);
    5858  }
    61   matrix::matrix(const matrix& o)
     61  Matrix::Matrix(const Matrix& o)
    6262    : blas_result_(NULL), m_(o.create_gsl_matrix_copy())
    6363  {
    6767  // Constructor that gets data from istream
    68   matrix::matrix(std::istream& is, char sep)
     68  Matrix::Matrix(std::istream& is, char sep)
    6969    throw (utility::IO_error,std::exception)
    7070    : blas_result_(NULL)
    113113      else if (v.size()!=nof_columns) {
    114114        std::ostringstream s;
    115         s << "matrix::matrix(std::istream&, char) data file error: "
     115        s << "Matrix::Matrix(std::istream&, char) data file error: "
    116116          << "line " << nof_rows << " has " << v.size()
    117117          << " columns; expected " << nof_columns << " columns.";
    126126    m_ = gsl_matrix_alloc ( nof_rows, nof_columns );
    127127    if (!m_)
    128       throw utility::GSL_error("matrix::matrix failed to allocate memory");
     128      throw utility::GSL_error("Matrix::Matrix failed to allocate memory");
    130130    // if gsl error handler disabled, out of bounds index will not
    138   matrix::~matrix(void)
     138  Matrix::~Matrix(void)
    139139  {
    140140    delete_allocated_memory();
    147   void matrix::all(const double value)
     147  void Matrix::all(const double value)
    148148  {
    149149    assert(m_);
    154   matrix::iterator matrix::begin(void)
     154  Matrix::iterator Matrix::begin(void)
    155155  {
    156156    return iterator(&(*this)(0,0), 1);
    160   matrix::const_iterator matrix::begin(void) const
     160  Matrix::const_iterator Matrix::begin(void) const
    161161  {
    162162    return const_iterator(&(*this)(0,0), 1);
    166   matrix::column_iterator matrix::begin_column(size_t i)
     166  Matrix::column_iterator Matrix::begin_column(size_t i)
    167167  {
    168168    return iterator(&(*this)(0,i), this->columns());
    172   matrix::const_column_iterator matrix::begin_column(size_t i) const
     172  Matrix::const_column_iterator Matrix::begin_column(size_t i) const
    173173  {
    174174    return const_iterator(&(*this)(0,i), this->columns());
    178   matrix::row_iterator matrix::begin_row(size_t i)
     178  Matrix::row_iterator Matrix::begin_row(size_t i)
    179179  {
    180180    return iterator(&(*this)(i,0), 1);
    184   matrix::const_row_iterator matrix::begin_row(size_t i) const
     184  Matrix::const_row_iterator Matrix::begin_row(size_t i) const
    185185  {
    186186    return const_iterator(&(*this)(i,0), 1);
    190   VectorView matrix::column_view(size_t col)
     190  VectorView Matrix::column_view(size_t col)
    191191  {
    192192    VectorView res(*this, col, false);
    197   const VectorConstView matrix::column_const_view(size_t col) const
     197  const VectorConstView Matrix::column_const_view(size_t col) const
    198198  {
    199199    return VectorConstView(*this, col, false);
    203   size_t matrix::columns(void) const
     203  size_t Matrix::columns(void) const
    204204  {
    205205    return (m_ ? m_->size2 : 0);
    209   gsl_matrix* matrix::create_gsl_matrix_copy(void) const
     209  gsl_matrix* Matrix::create_gsl_matrix_copy(void) const
    210210  {
    211211    gsl_matrix* m = gsl_matrix_alloc(rows(),columns());
    212212    if (!m)
    213       throw utility::GSL_error("matrix::create_gsl_matrix_copy failed to allocate memory");
     213      throw utility::GSL_error("Matrix::create_gsl_matrix_copy failed to allocate memory");
    214214    if (gsl_matrix_memcpy(m,m_))
    215       throw utility::GSL_error("matrix::create_gsl_matrix_copy dimension mis-match");
     215      throw utility::GSL_error("Matrix::create_gsl_matrix_copy dimension mis-match");
    216216    return m;
    217217  }
    220   void matrix::delete_allocated_memory(void)
     220  void Matrix::delete_allocated_memory(void)
    221221  {
    222222    if (m_)
    228   void matrix::div(const matrix& other)
     228  void Matrix::div(const Matrix& other)
    229229  {
    230230    assert(m_);
    237   matrix::iterator matrix::end(void)
     237  Matrix::iterator Matrix::end(void)
    238238  {
    239239    return iterator(&(*this)(0,0)+rows()*columns(), 1);
    243   matrix::const_iterator matrix::end(void) const
     243  Matrix::const_iterator Matrix::end(void) const
    244244  {
    245245    return const_iterator(&(*this)(0,0)+rows()*columns(), 1);
    249   matrix::column_iterator matrix::end_column(size_t i)
     249  Matrix::column_iterator Matrix::end_column(size_t i)
    250250  {
    251251    return column_iterator(&(*this)(0,i)+rows()*columns(), this->columns());
    255   matrix::const_column_iterator matrix::end_column(size_t i) const
     255  Matrix::const_column_iterator Matrix::end_column(size_t i) const
    256256  {
    257257    return const_column_iterator(&(*this)(0,i)+rows()*columns(),this->columns());
    261   matrix::row_iterator matrix::end_row(size_t i)
     261  Matrix::row_iterator Matrix::end_row(size_t i)
    262262  {
    263263    return row_iterator(&(*this)(i,0)+columns(), 1);
    267   matrix::const_row_iterator matrix::end_row(size_t i) const
     267  Matrix::const_row_iterator Matrix::end_row(size_t i) const
    268268  {
    269269    return const_row_iterator(&(*this)(i,0)+columns(), 1);
    273   bool matrix::equal(const matrix& other, const double d) const
     273  bool Matrix::equal(const Matrix& other, const double d) const
    274274  {
    275275    if (this==&other)
    289   const gsl_matrix* matrix::gsl_matrix_p(void) const
     289  const gsl_matrix* Matrix::gsl_matrix_p(void) const
    290290  {
    291291    return m_;
    295   gsl_matrix* matrix::gsl_matrix_p(void)
     295  gsl_matrix* Matrix::gsl_matrix_p(void)
    296296  {
    297297    return m_;
    301   void matrix::mul(const matrix& other)
     301  void Matrix::mul(const Matrix& other)
    302302  {
    303303    assert(m_);
    304304    int status=gsl_matrix_mul_elements(m_, other.gsl_matrix_p());
    305305    if (status)
    306       throw utility::GSL_error(std::string("matrix::mul_elements",status));
    307   }
    310   void matrix::resize(size_t r, size_t c, double init_value)
     306      throw utility::GSL_error(std::string("Matrix::mul_elements",status));
     307  }
     310  void Matrix::resize(size_t r, size_t c, double init_value)
    311311  {
    312312    delete_allocated_memory();
    314314    m_ = gsl_matrix_alloc(r,c);
    315315    if (!m_)
    316       throw utility::GSL_error("matrix::matrix failed to allocate memory");
     316      throw utility::GSL_error("Matrix::Matrix failed to allocate memory");
    317317    all(init_value);
    328   size_t matrix::rows(void) const
     328  size_t Matrix::rows(void) const
    329329  {
    330330    return (m_ ? m_->size1 : 0);
    334   const VectorConstView matrix::row_const_view(size_t col) const
     334  const VectorConstView Matrix::row_const_view(size_t col) const
    335335  {
    336336    return VectorConstView(*this, col, true);
    340   VectorView matrix::row_view(size_t row)
     340  VectorView Matrix::row_view(size_t row)
    341341  {
    342342    VectorView res(*this, row, true);
    347   void matrix::swap_columns(const size_t i, const size_t j)
     347  void Matrix::swap_columns(const size_t i, const size_t j)
    348348  {
    349349    assert(m_);
    350350    int status=gsl_matrix_swap_columns(m_, i, j);
    351351    if (status)
    352       throw utility::GSL_error(std::string("matrix::swap_columns",status));
    353   }
    356   void matrix::swap_rowcol(const size_t i, const size_t j)
     352      throw utility::GSL_error(std::string("Matrix::swap_columns",status));
     353  }
     356  void Matrix::swap_rowcol(const size_t i, const size_t j)
    357357  {
    358358    assert(m_);
    359359    int status=gsl_matrix_swap_rowcol(m_, i, j);
    360360    if (status)
    361       throw utility::GSL_error(std::string("matrix::swap_rowcol",status));
    362   }
    365   void matrix::swap_rows(const size_t i, const size_t j)
     361      throw utility::GSL_error(std::string("Matrix::swap_rowcol",status));
     362  }
     365  void Matrix::swap_rows(const size_t i, const size_t j)
    366366  {
    367367    assert(m_);
    368368    int status=gsl_matrix_swap_rows(m_, i, j);
    369369    if (status)
    370       throw utility::GSL_error(std::string("matrix::swap_rows",status));
    371   }
    374   void matrix::transpose(void)
     370      throw utility::GSL_error(std::string("Matrix::swap_rows",status));
     371  }
     374  void Matrix::transpose(void)
    375375  {
    376376    assert(m_);
    380380      gsl_matrix* transposed = gsl_matrix_alloc(columns(),rows());
    381381      if (!transposed)
    382         throw utility::GSL_error("matrix::transpose failed to allocate memory");
     382        throw utility::GSL_error("Matrix::transpose failed to allocate memory");
    383383      // next line never fails if allocation above succeeded.
    384384      gsl_matrix_transpose_memcpy(transposed,m_);
    395   double& matrix::operator()(size_t row, size_t column)
     395  double& Matrix::operator()(size_t row, size_t column)
    396396  {
    397397    assert(m_);
    400400    double* d=gsl_matrix_ptr(m_, row, column);
    401401    if (!d)
    402       throw utility::GSL_error("matrix::operator()",GSL_EINVAL);
     402      throw utility::GSL_error("Matrix::operator()",GSL_EINVAL);
    403403    return *d;
    404404  }
    407   const double& matrix::operator()(size_t row, size_t column) const
     407  const double& Matrix::operator()(size_t row, size_t column) const
    408408  {
    409409    assert(row<rows());
    411411    const double* d=gsl_matrix_const_ptr(m_, row, column);
    412412    if (!d)
    413       throw utility::GSL_error("matrix::operator()",GSL_EINVAL);
     413      throw utility::GSL_error("Matrix::operator()",GSL_EINVAL);
    414414    return *d;
    415415  }
    418   bool matrix::operator==(const matrix& other) const
     418  bool Matrix::operator==(const Matrix& other) const
    419419  {
    420420    return equal(other);
    424   bool matrix::operator!=(const matrix& other) const
     424  bool Matrix::operator!=(const Matrix& other) const
    425425  {
    426426    return !equal(other);
    430   const matrix& matrix::operator=( const matrix& other )
     430  const Matrix& Matrix::operator=( const Matrix& other )
    431431  {
    432432    assert(other.m_);
    435435        resize(other.m_->size1,other.m_->size2);
    436436      if (gsl_matrix_memcpy(m_, other.gsl_matrix_p()))
    437         throw utility::GSL_error("matrix::create_gsl_matrix_copy dimension mis-match");
     437        throw utility::GSL_error("Matrix::create_gsl_matrix_copy dimension mis-match");
    438438    }
    439439    return *this;
    443   const matrix& matrix::operator+=(const matrix& other)
     443  const Matrix& Matrix::operator+=(const Matrix& other)
    444444  {
    445445    assert(m_);
    446446    int status=gsl_matrix_add(m_, other.m_);
    447447    if (status)
    448       throw utility::GSL_error(std::string("matrix::operator+=", status));
    449     return *this;
    450   }
    453   const matrix& matrix::operator+=(const double d)
     448      throw utility::GSL_error(std::string("Matrix::operator+=", status));
     449    return *this;
     450  }
     453  const Matrix& Matrix::operator+=(const double d)
    454454  {
    455455    assert(m_);
    461   const matrix& matrix::operator-=(const matrix& other)
     461  const Matrix& Matrix::operator-=(const Matrix& other)
    462462  {
    463463    assert(m_);
    464464    int status=gsl_matrix_sub(m_, other.m_);
    465465    if (status)
    466       throw utility::GSL_error(std::string("matrix::operator-=", status));
    467     return *this;
    468   }
    471   const matrix& matrix::operator-=(const double d)
     466      throw utility::GSL_error(std::string("Matrix::operator-=", status));
     467    return *this;
     468  }
     471  const Matrix& Matrix::operator-=(const double d)
    472472  {
    473473    assert(m_);
    479   const matrix& matrix::operator*=(const matrix& other)
     479  const Matrix& Matrix::operator*=(const Matrix& other)
    480480  {
    481481    assert(m_);
    488488      blas_result_ = gsl_matrix_alloc(rows(),other.columns());
    489489      if (!blas_result_)
    490         throw utility::GSL_error("matrix::operator*= failed to allocate memory");
     490        throw utility::GSL_error("Matrix::operator*= failed to allocate memory");
    491491    }
    492492    gsl_blas_dgemm(CblasNoTrans, CblasNoTrans, 1.0, m_, other.m_, 0.0, blas_result_);
    500   const matrix& matrix::operator*=(const double d)
     500  const Matrix& Matrix::operator*=(const double d)
    501501  {
    502502    assert(m_);
    508   bool isnull(const matrix& other)
     508  bool isnull(const Matrix& other)
    509509  {
    510510    return gsl_matrix_isnull(other.gsl_matrix_p());
    514   double max(const matrix& other)
     514  double max(const Matrix& other)
    515515  {
    516516    return gsl_matrix_max(other.gsl_matrix_p());
    520   double min(const matrix& other)
     520  double min(const Matrix& other)
    521521  {
    522522    return gsl_matrix_min(other.gsl_matrix_p());
    526   void minmax_index(const matrix& other,
     526  void minmax_index(const Matrix& other,
    527527                    std::pair<size_t,size_t>& min, std::pair<size_t,size_t>& max)
    528528  {
    534   bool nan(const matrix& templat, matrix& flag)
     534  bool nan(const Matrix& templat, Matrix& flag)
    535535  {
    536536    size_t rows=templat.rows();
    553   void swap(matrix& a, matrix& b)
     553  void swap(Matrix& a, Matrix& b)
    554554  {
    555555    assert(a.gsl_matrix_p()); assert(b.gsl_matrix_p());
    556556    int status=gsl_matrix_swap(a.gsl_matrix_p(), b.gsl_matrix_p());
    557557    if (status)
    558       throw utility::GSL_error(std::string("swap(matrix&,matrix&)",status));
    559   }
    562   std::ostream& operator<<(std::ostream& s, const matrix& m)
     558      throw utility::GSL_error(std::string("swap(Matrix&,Matrix&)",status));
     559  }
     562  std::ostream& operator<<(std::ostream& s, const Matrix& m)
    563563  {
    564564    s.setf(std::ios::dec);
    578   Vector operator*(const matrix& m, const VectorBase& v)
     578  Vector operator*(const Matrix& m, const VectorBase& v)
    579579  {
    580580    utility::Vector res(m.rows());
    587   Vector operator*(const VectorBase& v, const matrix& m)
     587  Vector operator*(const VectorBase& v, const Matrix& m)
    588588  {
    589589    utility::Vector res(m.columns());
  • trunk/yat/utility/Matrix.h

    r1120 r1121  
    6262  /// superdiagonals.
    6363  ///
    64   class matrix
     64  class Matrix
    6565  {
    6666  public:
    9595       structures.
    9696    */
    97     matrix(void);
     97    Matrix(void);
    9999    /**
    103103       \throw GSL_error if memory allocation fails.
    104104    */
    105     matrix(const size_t& r, const size_t& c, double init_value=0);
     105    Matrix(const size_t& r, const size_t& c, double init_value=0);
    107107    /**
    111111       fails.
    112112    */
    113     matrix(const matrix&);
     113    Matrix(const Matrix&);
    115115    /**
    127127       unexpected input is found in the input stream.
    128128    */
    129     explicit matrix(std::istream &, char sep='\0')
     129    explicit Matrix(std::istream &, char sep='\0')
    130130      throw(utility::IO_error, std::exception);
    133133       \brief The destructor.
    134134    */
    135     ~matrix(void);
     135    ~Matrix(void);
    137137    ///
    206206       \throw GSL_error if dimensions mis-match.
    207207    */
    208     void div(const matrix& b);
     208    void div(const Matrix& b);
    210210    /**
    247247       \see operator== and operator!=
    248248    */
    249     bool equal(const matrix&, const double precision=0) const;
     249    bool equal(const Matrix&, const double precision=0) const;
    251251    ///
    261261    /**
    262        Multiply the elements of matrix \a b with the elements of the
    263        calling matrix ,\f$ a_{ij} = a_{ij} * b_{ij} \; \forall i,j
    264        \f$. The result is stored into the calling matrix.
     262       Multiply the elements of Matrix \a b with the elements of the
     263       calling Matrix ,\f$ a_{ij} = a_{ij} * b_{ij} \; \forall i,j
     264       \f$. The result is stored into the calling Matrix.
    266266       \throw GSL_error if dimensions mis-match.
    267267    */
    268     void mul(const matrix& b);
    270     /**
    271        \brief Resize matrix
     268    void mul(const Matrix& b);
     270    /**
     271       \brief Resize Matrix
    273273       All elements are set to @a init_value.
    275275       \note underlying GSL matrix is destroyed and views into this
    276        matrix becomes invalid.
     276       Matrix becomes invalid.
    277277    */
    278278    void resize(size_t, size_t, double init_value=0);
    303303       \brief Swap row \a i and column \a j.
    305        The matrix must be square.
     305       The Matrix must be square.
    307307       \throw GSL_error if either index is out of bounds, or if matrix
    359359       \see equal
    360360    */
    361     bool operator==(const matrix& other) const;
     361    bool operator==(const Matrix& other) const;
    363363    /**
    372372       \see equal
    373373    */
    374     bool operator!=(const matrix& other) const;
     374    bool operator!=(const Matrix& other) const;
    376376    /**
    377377       \brief The assignment operator.
    379        \return A const reference to the resulting matrix.
    380     */
    381     const matrix& operator=(const matrix& other);
     379       \return A const reference to the resulting Matrix.
     380    */
     381    const Matrix& operator=(const Matrix& other);
    383383    /**
    384384       \brief Add and assign operator.
    386        Elementwise addition of the elements of matrix \a b to the left
    387        hand side matrix ,\f$ a_{ij} = a_{ij} + b_{ij} \; \forall i,j
     386       Elementwise addition of the elements of Matrix \a b to the left
     387       hand side Matrix ,\f$ a_{ij} = a_{ij} + b_{ij} \; \forall i,j
    388388       \f$.
    390        \return A const reference to the resulting matrix.
     390       \return A const reference to the resulting Matrix.
    392392       \throw GSL_error if dimensions mis-match.
    393393    */
    394     const matrix& operator+=(const matrix& b);
     394    const Matrix& operator+=(const Matrix& b);
    396396    /**
    397397       \brief Add and assign operator
    399        Add the scalar value \a d to the left hand side matrix, \f$
     399       Add the scalar value \a d to the left hand side Matrix, \f$
    400400       a_{ij} = a_{ij} + d \; \forall i,j \f$.
    401401    */
    402     const matrix& operator+=(const double d);
     402    const Matrix& operator+=(const double d);
    404404    /**
    405405       \brief Subtract and assign operator.
    407        Elementwise subtraction of the elements of matrix \a b to the
    408        left hand side matrix ,\f$ a_{ij} = a_{ij} + b_{ij} \; \forall
     407       Elementwise subtraction of the elements of Matrix \a b to the
     408       left hand side Matrix ,\f$ a_{ij} = a_{ij} + b_{ij} \; \forall
    409409       i,j \f$.
    411        \return A const reference to the resulting matrix.
     411       \return A const reference to the resulting Matrix.
    413413       \throw GSL_error if dimensions mis-match.
    414414    */
    415     const matrix& operator-=(const matrix&);
     415    const Matrix& operator-=(const Matrix&);
    417417    /**
    418418       \brief Subtract and assign operator
    420        Subtract the scalar value \a d to the left hand side matrix,
     420       Subtract the scalar value \a d to the left hand side Matrix,
    421421       \f$ a_{ij} = a_{ij} + d \; \forall i,j \f$.
    422422    */
    423     const matrix& operator-=(const double d);
     423    const Matrix& operator-=(const double d);
    425425    /**
    426426       \brief Multiply and assigment operator.
    428        \return Const reference to the resulting matrix.
     428       \return Const reference to the resulting Matrix.
    430430       \throw GSL_error if memory allocation fails.
    431431    */
    432     const matrix& operator*=(const matrix&);
     432    const Matrix& operator*=(const Matrix&);
    434434    /**
    435435       \brief Multiply and assignment operator
    437        Multiply the elements of the left hand side matrix with a
     437       Multiply the elements of the left hand side Matrix with a
    438438       scalar \a d, \f$ a_{ij} = d * a_{ij} \; \forall i,j \f$.
    440440       \throw GSL_error if memory allocation fails.
    441441    */
    442     const matrix& operator*=(double d);
     442    const Matrix& operator*=(double d);
    444444  private:
    474474  /**
    475      \brief Check if all elements of the matrix are zero.
    477      \return True if all elements in the matrix is zero, false
     475     \brief Check if all elements of the Matrix are zero.
     477     \return True if all elements in the Matrix is zero, false
    478478     othwerwise.
    479479  */
    480   bool isnull(const matrix&);
    482   /**
    483      \brief Get the maximum value of the matrix.
    485      \return The maximum value of the matrix.
    486   */
    487   double max(const matrix&);
    489   /**
    490      \brief Get the minimum value of the matrix.
    492      \return The minimum value of the matrix.
    493   */
    494   double min(const matrix&);
    496   /**
    497      \brief Locate the maximum and minumum element in the matrix.
     480  bool isnull(const Matrix&);
     482  /**
     483     \brief Get the maximum value of the Matrix.
     485     \return The maximum value of the Matrix.
     486  */
     487  double max(const Matrix&);
     489  /**
     490     \brief Get the minimum value of the Matrix.
     492     \return The minimum value of the Matrix.
     493  */
     494  double min(const Matrix&);
     496  /**
     497     \brief Locate the maximum and minumum element in the Matrix.
    499499     \return The indecies to the element with the minimum and maximum
    500      values of the matrix, respectively.
     500     values of the Matrix, respectively.
    502502     \note Lower index has precedence (searching in row-major order).
    503503  */
    504   void minmax_index(const matrix&,
     504  void minmax_index(const Matrix&,
    505505                    std::pair<size_t,size_t>& min,
    506506                    std::pair<size_t,size_t>& max);
    508508  /**
    509      \brief Create a matrix \a flag indicating NaN's in another matrix
     509     \brief Create a Matrix \a flag indicating NaN's in another Matrix
    510510     \a templat.
    512      The \a flag matrix is changed to contain 1's and 0's only. A 1
    513      means that the corresponding element in the \a templat matrix is
     512     The \a flag Matrix is changed to contain 1's and 0's only. A 1
     513     means that the corresponding element in the \a templat Matrix is
    514514     valid and a zero means that the corresponding element is a NaN.
    516      \note Space for matrix \a flag is reallocated to fit the size of
    517      matrix \a templat if sizes mismatch.
    519      \return True if the \a templat matrix contains at least one NaN.
    520   */
    521   bool nan(const matrix& templat, matrix& flag);
     516     \note Space for Matrix \a flag is reallocated to fit the size of
     517     Matrix \a templat if sizes mismatch.
     519     \return True if the \a templat Matrix contains at least one NaN.
     520  */
     521  bool nan(const Matrix& templat, Matrix& flag);
    523523  /**
    528528     \throw GSL_error if either index is out of bounds.
    529529  */
    530   void swap(matrix&, matrix&);
    532   /**
    533      \brief The output operator for the matrix class.
    534   */
    535   std::ostream& operator<< (std::ostream& s, const matrix&);
    537   /**
    538      \brief vector matrix multiplication
     530  void swap(Matrix&, Matrix&);
     532  /**
     533     \brief The output operator for the Matrix class.
     534  */
     535  std::ostream& operator<< (std::ostream& s, const Matrix&);
     537  /**
     538     \brief vector Matrix multiplication
    539539   */
    540   Vector operator*(const matrix&, const VectorBase&);
    542   /**
    543      \brief matrix vector multiplication
     540  Vector operator*(const Matrix&, const VectorBase&);
     542  /**
     543     \brief Matrix vector multiplication
    544544   */
    545   Vector operator*(const VectorBase&, const matrix&);
     545  Vector operator*(const VectorBase&, const Matrix&);
    547547}}} // of namespace utility, yat, and theplu
  • trunk/yat/utility/

    r1000 r1121  
    3838  // implementations here see the paper cited in the class definition
    3939  // documentation.
    40   NNI::NNI(const utility::matrix& matrix,const utility::matrix& weight,
     40  NNI::NNI(const utility::Matrix& matrix,const utility::Matrix& weight,
    4141           const u_int neighbours)
    4242    : data_(matrix), imputed_data_(matrix), neighbours_(neighbours),
    77   const utility::matrix& NNI::imputed_data(void) const
     77  const utility::Matrix& NNI::imputed_data(void) const
    7878  {
    7979    return imputed_data_;
  • trunk/yat/utility/NNI.h

    r1000 r1121  
    29 #include "matrix.h"
     29#include "Matrix.h"
    3131#include <iostream>
    8888    /// algorithms.
    8989    ///
    90     NNI(const utility::matrix& matrix,const utility::matrix& weight,
     90    NNI(const utility::Matrix& matrix,const utility::Matrix& weight,
    9191        const u_int neighbours);
    103103    /// @return A const reference to the modified data.
    104104    ///
    105     const utility::matrix& imputed_data(void) const;
     105    const utility::Matrix& imputed_data(void) const;
    107107    ///
    124124    /// original data matrix
    125125    ///
    126     const utility::matrix& data_;
     126    const utility::Matrix& data_;
    128128    ///
    129129    /// data after imputation
    130130    ///
    131     utility::matrix imputed_data_;
     131    utility::Matrix imputed_data_;
    133133    ///
    144144    /// weight matrix
    145145    ///
    146     const utility::matrix& weight_;
     146    const utility::Matrix& weight_;
    147147  };
  • trunk/yat/utility/

    r1120 r1121  
    42   PCA::PCA(const utility::matrix& A)
     42  PCA::PCA(const utility::Matrix& A)
    4343    : A_(A)
    4444  {
    55   const utility::matrix& PCA::eigenvectors(void) const
     55  const utility::Matrix& PCA::eigenvectors(void) const
    5656  {
    5757    return eigenvectors_;
    6262  {
    6363    // Row-center the data matrix
    64     utility::matrix A_center( A_.rows(), A_.columns() );
     64    utility::Matrix A_center( A_.rows(), A_.columns() );
    6565    this->row_center( A_center );
    6868    std::auto_ptr<SVD> pSVD( new SVD( A_center ) );
    6969    pSVD->decompose();
    70     utility::matrix U(pSVD->U());
    71     utility::matrix V(pSVD->V());
     70    utility::Matrix U(pSVD->U());
     71    utility::Matrix V(pSVD->V());
    7373    // Read the eigenvectors and eigenvalues
    143   utility::matrix PCA::projection(const utility::matrix& samples ) const
     143  utility::Matrix PCA::projection(const utility::Matrix& samples ) const
    144144  {
    145145    const size_t Ncol = samples.columns();
    146146    const size_t Nrow = samples.rows();
    147     utility::matrix projs( Ncol, Ncol );
     147    utility::Matrix projs( Ncol, Ncol );
    149149    utility::Vector temp(samples.rows());
    189189  // that is, A_ = A_ - M, where M is a matrix
    190190  // with the meanvalues of each row
    191   void PCA::row_center(utility::matrix& A_center)
     191  void PCA::row_center(utility::Matrix& A_center)
    192192  {
    193193    meanvalues_ = Vector(A_.rows());
  • trunk/yat/utility/PCA.h

    r1120 r1121  
    31 #include "matrix.h"
     31#include "Matrix.h"
    3232#include "Vector.h"
    5656       should have been performed and no products.
    5757     */
    58     explicit PCA(const utility::matrix&);
     58    explicit PCA(const utility::Matrix&);
    6060    /**
    8181       eigenvectors.
    8282    */
    83     const utility::matrix& eigenvectors(void) const;
     83    const utility::Matrix& eigenvectors(void) const;
    8585    /**
    9090       spanned by the eigenvectors.
    9191    */
    92     utility::matrix projection( const utility::matrix& ) const;
     92    utility::Matrix projection( const utility::Matrix& ) const;
    9494    /**
    116116       with the meanvalues of each row
    117117    */
    118     void row_center( utility::matrix& A_center );
     118    void row_center( utility::Matrix& A_center );
    120     utility::matrix A_;
     120    utility::Matrix A_;
    121121    utility::Vector eigenvalues_;
    122     utility::matrix eigenvectors_;
     122    utility::Matrix eigenvectors_;
    123123    utility::Vector meanvalues_;
    124124  };
  • trunk/yat/utility/

    r1120 r1121  
    38   SVD::SVD(const utility::matrix& Ain)
     38  SVD::SVD(const utility::Matrix& Ain)
    3939    : U_(Ain), V_(Ain.columns(),Ain.columns()), s_(Ain.columns())
    4040  {
    8888  {
    8989    utility::Vector w(U_.columns());
    90     utility::matrix X(U_.columns(),U_.columns());
     90    utility::Matrix X(U_.columns(),U_.columns());
    9191    return gsl_linalg_SV_decomp_mod(U_.gsl_matrix_p(), X.gsl_matrix_p(),
    9292                                    V_.gsl_matrix_p(), s_.gsl_vector_p(),
    113   const utility::matrix& SVD::U(void) const
     113  const utility::Matrix& SVD::U(void) const
    114114  {
    115115    return U_;
    119   const utility::matrix& SVD::V(void) const
     119  const utility::Matrix& SVD::V(void) const
    120120  {
    121121    return V_;
  • trunk/yat/utility/SVD.h

    r1120 r1121  
    31 #include "matrix.h"
     31#include "Matrix.h"
    3232#include "Vector.h"
    8080       object.
    8181    */
    82     SVD(const utility::matrix& Ain);
     82    SVD(const utility::Matrix& Ain);
    8484    /**
    124124       is undefined.
    125125    */
    126     const utility::matrix& U(void) const;
     126    const utility::Matrix& U(void) const;
    128128    /**
    134134       is undefined.
    135135    */
    136     const utility::matrix& V(void) const;
     136    const utility::Matrix& V(void) const;
    138138  private:
    158158    int modified_golub_reinsch(void);
    160     utility::matrix U_, V_;
     160    utility::Matrix U_, V_;
    161161    utility::Vector s_;
    162162  }; 
  • trunk/yat/utility/

    r1120 r1121  
    2727#include "Vector.h"
    28 #include "matrix.h"
    2928#include "utility.h"
    3029#include "yat/random/random.h"
  • trunk/yat/utility/

    r1120 r1121  
    2727#include "VectorBase.h"
    28 #include "matrix.h"
     28#include "Vector.h"
    2929#include "utility.h"
    3030#include "yat/random/random.h"
  • trunk/yat/utility/

    r1029 r1121  
    2727#include "VectorConstView.h"
    28 #include "matrix.h"
     28#include "Matrix.h"
    3030namespace theplu {
    58   VectorConstView::VectorConstView(const matrix& m, size_t i, bool row)
     58  VectorConstView::VectorConstView(const Matrix& m, size_t i, bool row)
    5959    : VectorBase(), const_view_(NULL)
    6060  {
  • trunk/yat/utility/VectorConstView.h

    r1029 r1121  
    3838namespace utility {
    40   class matrix;
     40  class Matrix;
    4242  /**
    100100       use is undefined.
    101101    */
    102     VectorConstView(const matrix& m, size_t i, bool row=true);
     102    VectorConstView(const Matrix& m, size_t i, bool row=true);
    104104    /**
  • trunk/yat/utility/

    r1118 r1121  
    2727#include "VectorMutable.h"
    28 #include "matrix.h"
    2928#include "utility.h"
    3029#include "yat/random/random.h"
  • trunk/yat/utility/

    r1118 r1121  
    2727#include "VectorView.h"
    2828#include "VectorMutable.h"
    29 #include "matrix.h"
     29#include "Matrix.h"
    3030#include "utility.h"
    3131#include "yat/random/random.h"
    79   VectorView::VectorView(matrix& m, size_t i, bool row)
     79  VectorView::VectorView(Matrix& m, size_t i, bool row)
    8080    : VectorMutable()
    8181  {
  • trunk/yat/utility/VectorView.h

    r1120 r1121  
    4343namespace utility {
    45   class matrix;
     45  class Matrix;
    4646  class Vector;
    144144    /// use is undefined.
    145145    ///
    146     VectorView(matrix& m, size_t i, bool row=true);
     146    VectorView(Matrix& m, size_t i, bool row=true);
    148148    /**
  • trunk/yat/utility/

    r1000 r1121  
    2626#include "WeNNI.h"
    27 #include "matrix.h"
     27#include "Matrix.h"
    2828#include "stl_utility.h"
    39   WeNNI::WeNNI(const utility::matrix& matrix,const utility::matrix& flag,
     39  WeNNI::WeNNI(const utility::Matrix& matrix,const utility::Matrix& flag,
    4040               const u_int neighbours)
    4141    : NNI(matrix,flag,neighbours), imputed_data_raw_(matrix)
  • trunk/yat/utility/WeNNI.h

    r1000 r1121  
    3030#include "NNI.h"
    31 #include "matrix.h"
     31#include "Matrix.h"
    3333#include <iostream>
    5454    /// Constructor
    5555    ///
    56     WeNNI(const utility::matrix& matrix,const utility::matrix& weight,
     56    WeNNI(const utility::Matrix& matrix,const utility::Matrix& weight,
    5757          const u_int neighbours);
    6767    /// @return A const reference to imputed_data_raw.
    6868    ///
    69     const utility::matrix& imputed_data_raw(void) const
     69    const utility::Matrix& imputed_data_raw(void) const
    7070    { return imputed_data_raw_; }
    7373  private:
    75     utility::matrix imputed_data_raw_;
     75    utility::Matrix imputed_data_raw_;
    7676  };
  • trunk/yat/utility/

    r1000 r1121  
    3636namespace utility {
    38   kNNI::kNNI(const utility::matrix& matrix,const utility::matrix& flag,
     38  kNNI::kNNI(const utility::Matrix& matrix,const utility::Matrix& flag,
    3939             const u_int neighbours)
    4040    : NNI(matrix,flag,neighbours)
  • trunk/yat/utility/kNNI.h

    r1000 r1121  
    5555    /// Constructor
    5656    ///
    57     kNNI(const utility::matrix& matrix,const utility::matrix& weight,
     57    kNNI(const utility::Matrix& matrix,const utility::Matrix& weight,
    5858         const u_int neighbours);
Note: See TracChangeset for help on using the changeset viewer.