Changeset 2846 for branches/0.9-stable


Ignore:
Timestamp:
Sep 22, 2012, 11:30:55 AM (9 years ago)
Author:
Peter
Message:

Merged r2845 into 0.9.x branch and marked alignment.test as XFAIL. refs #724.

Location:
branches/0.9-stable
Files:
3 edited

Legend:

Unmodified
Added
Removed
  • branches/0.9-stable

  • branches/0.9-stable/test/Makefile.am

    r2844 r2846  
    6868
    6969# tests not passing through yet
    70 XFAIL_TESTS =
     70XFAIL_TESTS = test/alignment.test
    7171
    7272DISTRIBUTED_TESTS = \
  • branches/0.9-stable/test/alignment.cc

    r2817 r2846  
    101101  s >> peaksets;
    102102
     103  utility::Matrix nm_score(peaksets.size(), peaksets.size(), 0);
     104  utility::Matrix correct(nm_score);
    103105  for (size_t i=0; i<peaksets.size()-1; i++)
    104106    for (size_t j=i+1; j<peaksets.size(); j++) {
    105107      utility::Matrix dot_m;
    106108      std::vector<std::pair<size_t,size_t> > path;
    107       score(peaksets[i], peaksets[j], 1.0, dot_m, path);
     109      nm_score(i,j) = score(peaksets[i], peaksets[j], 1.0, dot_m, path);
     110      if (i==2 && j==3) {
     111        for (size_t r=0; r<dot_m.rows(); ++r)
     112          for (size_t c=0; c<dot_m.columns(); ++c)
     113            if (dot_m(r,c) > 1e-5)
     114              std::cerr << r << " " << c << " " << dot_m(r,c) << "\n";
     115      }
    108116    }
     117  correct(0,1) = 4.947983;
     118  correct(0,2) = 3.496081;
     119  correct(0,3) = 4.960331;
     120  correct(1,2) = 2.486868;
     121  correct(1,3) = 11.407001;
     122  correct(2,3) = 2.503420;
     123
     124  suite.add(suite.equal_range_fix(nm_score.begin(), nm_score.end(),
     125                                  correct.begin(), 1e-6));
    109126
    110127  std::string a("AGGUUGUCCGUGGUGAGUUCGCA");
Note: See TracChangeset for help on using the changeset viewer.