Changeset 2853


Ignore:
Timestamp:
Sep 24, 2012, 1:56:38 AM (9 years ago)
Author:
Peter
Message:

merge patch release 0.9.1 into trunk

Location:
trunk
Files:
12 edited
2 copied

Legend:

Unmodified
Added
Removed
  • trunk

  • trunk/Makefile.am

    r2787 r2853  
    3232EXTRA_DIST =
    3333MOSTLYCLEANFILES =
     34## append targets to this variable for tests included in 'make installcheck'
     35INSTALL_CHECK_TARGETS =
    3436
    3537FORCE:
     
    6567  rm -rf doc/$(DX_HTML_OUTPUT) test/yathello test/testSubDir
    6668
     69installcheck-local: $(INSTALL_CHECK_TARGETS)
     70
    6771.PHONY: doc maintainer-check news-check svn-check svn-clean release
    6872
     
    97101  && $(MAKE) $(AM_MAKEFLAGS) clean \
    98102  && $(MAKE) $(AM_MAKEFLAGS) prefix=$$mcl_install \
     103  && $(MAKE) $(AM_MAKEFLAGS) prefix=$$mcl_install doc \
    99104  && $(MAKE) $(AM_MAKEFLAGS) prefix=$$mcl_install install \
    100105  && $(MAKE) $(AM_MAKEFLAGS) prefix=$$mcl_install installcheck
  • trunk/NEWS

    r2838 r2853  
    99
    1010yat 0.9.x series from http://dev.thep.lu.se/yat/svn/branches/0.9-stable
     11
     12version 0.9.1 (released 23 September 2012)
     13  - bug in Aligner fixed (see bug #724)
     14  - Commandline::parse now throws when finding '--no-foo' (bug #723)
     15  - yat.pc now mentions Boost::System and Boost::Thread in Libs.private (#722)
     16  - documentations is now installed again (bug #721)
     17
     18  A complete list of closed tickets can be found here [[br]]
     19  http://dev.thep.lu.se/yat/query?status=closed&milestone=yat+0.9.1
    1120
    1221version 0.9 (released 16 September 2012)
  • trunk/build_support/gen_yat_pc.sh.in

    r2623 r2853  
    22# @configure_input@
    33
    4 # Copyright (C) 2011 Peter Johansson
     4# Copyright (C) 2011, 2012 Peter Johansson
    55#
    66# This file is part of the yat library, http://dev.thep.lu.se/yat
     
    8484-e 's|@LDFLAGS[@]|@LDFLAGS@|g' \
    8585-e 's|@YAT_LDFLAGS[@]|@YAT_LDFLAGS@|g' \
     86-e 's|@BOOST_THREAD_LIB[@]|@BOOST_THREAD_LIB@|g' \
     87-e 's|@BOOST_SYSTEM_LIB[@]|@BOOST_SYSTEM_LIB@|g' \
    8688< $input
  • trunk/build_support/yat.pc.in

    r2264 r2853  
    22
    33# Copyright (C) 2008 Jari Häkkinen, Peter Johansson
    4 # Copyright (C) 2009, 2010 Peter Johansson
     4# Copyright (C) 2009, 2010, 2012 Peter Johansson
    55#
    66# This file is part of the yat library, http://dev.thep.lu.se/yat
     
    3030Requires: gsl >= @gsl_version@
    3131Libs: -L${libdir} -lyat @YAT_LDFLAGS@ @LDFLAGS@
     32Libs.private: @BOOST_THREAD_LIB@ @BOOST_SYSTEM_LIB@
    3233Cflags: @YAT_CPPFLAGS@ @YAT_CXXFLAGS@ @CPPFLAGS@ @CXXFLAGS@ -I${includedir}
  • trunk/doc/Makefile.am

    r2787 r2853  
    4444if DX_ENABLE_HTML
    4545html-local: doc/$(DX_HTML_OUTPUT)/index.html
     46INSTALL_CHECK_TARGETS += installcheck-html
    4647endif
    4748
     
    6566install-html-local:
    6667  @$(NORMAL_INSTALL)
    67   @if test -d $(DX_HTML_OUTPUT); then \
     68  @if test -d doc/$(DX_HTML_OUTPUT); then \
    6869    test -z "$(DESTDIR)$(htmldir)" || \
    6970    { $(MKDIR_P) "$(DESTDIR)$(htmldir)"; \
     
    7677  rm -rf $(DESTDIR)$(htmldir)
    7778
     79# check that html has been installed (only activated when DX_ENABLE_HTML)
     80## see ticket #721
     81installcheck-html:
     82  $(AM_V_at) test -r "$(DESTDIR)/$(htmldir)/index.html" \
     83  || { echo "no documentation installed" 1>&2; exit 1; }
     84  $(AM_V_at)grep "yat.*$(VERSION)" "$(DESTDIR)/$(htmldir)/index.html" \
     85  || { echo $(DESTDIR)/$(htmldir)/index.html not updated 1>&2; exit 1; }
     86
    7887MOSTLYCLEANFILES += doc/doxygen.error
  • trunk/m4/my_version.m4

    r2729 r2853  
    4040m4_define([my_PATCH_VERSION], [$3])
    4141m4_define([my_DEV_BUILD], [$4])
    42 m4_define([my_VERSION],[$1.$2m4_if([$3],[0],,[$3])m4_if([$4],[true],[pre])])
     42m4_define([my_VERSION],[$1.$2m4_if([$3],[0],,[.$3])m4_if([$4],[true],[pre])])
    4343]) # my_version
    4444
  • trunk/m4/version.m4

    r2838 r2853  
    6767# yat-0.8.2  5:2:0
    6868# yat-0.9    6:0:0
     69# yat-0.9.1  6:1:0
    6970#
    7071# *Accidently, the libtool number was not updated for yat 0.5
  • trunk/test/Makefile.am

    r2809 r2853  
    3333check_SCRIPTS = test/common_defs.sh
    3434
    35 EXTRA_PROGRAMS = test/alignment.test test/averager.test \
     35EXTRA_PROGRAMS = test/alignment.test \
     36  test/alignment2.test \
     37  test/averager.test \
    3638  test/averager1.test \
    3739  test/averager3.test \
     
    7173
    7274DISTRIBUTED_TESTS = \
     75test/cmd_test.sh \
    7376test/doxygen_test.sh \
    7477test/help_test.sh \
     
    104107
    105108# dependencies for lazycheck
     109test/cmd_test.log: test/help.test test/common_defs.sh
    106110test/help_test.log: test/help.test test/common_defs.sh
    107111test/static_test.log: $(srcdir)/m4/yat.m4 test/common_defs.sh
     
    196200  && rm -rf $(yat_hello_tmp_files)
    197201
    198 installcheck-local: yat-hello-check
     202INSTALL_CHECK_TARGETS += yat-hello-check
    199203
    200204yat-hello-check: $(srcdir)/test/yat-hello-1.0.tar.gz
  • trunk/test/alignment.cc

    r2817 r2853  
    101101  s >> peaksets;
    102102
     103  utility::Matrix nm_score(peaksets.size(), peaksets.size(), 0);
     104  utility::Matrix correct(nm_score);
    103105  for (size_t i=0; i<peaksets.size()-1; i++)
    104106    for (size_t j=i+1; j<peaksets.size(); j++) {
    105107      utility::Matrix dot_m;
    106108      std::vector<std::pair<size_t,size_t> > path;
    107       score(peaksets[i], peaksets[j], 1.0, dot_m, path);
     109      nm_score(i,j) = score(peaksets[i], peaksets[j], 1.0, dot_m, path);
     110      if (i==2 && j==3) {
     111        for (size_t r=0; r<dot_m.rows(); ++r)
     112          for (size_t c=0; c<dot_m.columns(); ++c)
     113            if (dot_m(r,c) > 1e-5)
     114              std::cerr << r << " " << c << " " << dot_m(r,c) << "\n";
     115      }
    108116    }
     117  correct(0,1) = 4.947983;
     118  correct(0,2) = 3.496081;
     119  correct(0,3) = 4.960331;
     120  correct(1,2) = 2.486868;
     121  correct(1,3) = 11.407001;
     122  correct(2,3) = 2.503420;
     123
     124  suite.add(suite.equal_range_fix(nm_score.begin(), nm_score.end(),
     125                                  correct.begin(), 1e-6));
    109126
    110127  std::string a("AGGUUGUCCGUGGUGAGUUCGCA");
  • trunk/yat/utility/Aligner.cc

    r2816 r2853  
    4848  double Aligner::needleman_wunsch(const Matrix& s)
    4949  {
    50     Matrix m(s.rows()+1,s.columns()+1, std::numeric_limits<double>::min());
     50    Matrix m(s.rows()+1,s.columns()+1, -std::numeric_limits<double>::max());
     51    m(0, 0) = 0.0;
    5152    // Init upper and left border of matrix
    5253    for (size_t i=1; i<m.rows(); i++)
     
    8586
    8687        if (cigar(i, j-1) == right) {
    87           if (x(i-1, j)-horizon_gap_ > x(i,j)) {
     88          if (x(i, j-1)-horizon_gap_ > x(i,j)) {
    8889            x(i,j) = x(i,j-1) - horizon_gap_;
    8990            cigar(i,j) = right;
  • trunk/yat/utility/CommandLine.cc

    r2609 r2853  
    44  Copyright (C) 2007 Jari Häkkinen, Peter Johansson, Markus Ringnér
    55  Copyright (C) 2008 Jari Häkkinen, Peter Johansson
    6   Copyright (C) 2009, 2010, 2011 Peter Johansson
     6  Copyright (C) 2009, 2010, 2011, 2012 Peter Johansson
    77
    88  This file is part of the yat library, http://dev.thep.lu.se/yat
     
    176176        iter->second->parse(arg, last);
    177177    }           
    178     else if (iter==long_options_.end()) {
     178    if (iter==long_options_.end()) {
    179179      std::stringstream ss3;
    180180      ss3 << "unrecognized option `" << key << "'\n" << try_help();
Note: See TracChangeset for help on using the changeset viewer.