Changeset 3222

Timestamp:

May 7, 2014, 5:37:33 AM (9 years ago)

Author:

Peter

Message:

prefer tp declare functions alphabetically. Implement BamRead::flag(void) which fixes #792

Location:

branches/0.12-stable

Files:

• test/bam.cc (modified) (3 diffs)
• yat/omic/BamRead.cc (modified) (1 diff)
• yat/omic/BamRead.h (modified) (3 diffs)

branches/0.12-stable/test/bam.cc

@@ -56 +56 @@
   suite.out() << "size: " << size << " " << bam.aux_size() << "\n";
   suite.add(bam.aux_size() == size+4);
+  bam.aux();
   bam.aux("ZZ");
   char c1 = bam_aux2A(bam.aux("ZZ"));
@@ -70 +71 @@
   BamRead bam(b);
 
+  bam.cigar();
+  bam.cigar(0);
+  bam.cigar_op(0);
+  bam.cigar_oplen(0);
+
   suite.out() << "test cigar:\n";
   suite.out() << bam.cigar_str() << "\n";
@@ -227 +233 @@
   BamRead bam;
   in.read(bam);
+  // test that functions are implemented
+  bam.end();
+  bam.flag();
+  bam.mpos();
+  bam.mtid();
+  bam.pos();
+  bam.tid();
+  bam.swap(bam);
   std::string str = "AGCTTTGTTATTATTTGAGGGTGTGGTTCAGTTGTAAACAGTGTATG"
     "TTTTAGAATTTGTGTTATTGTGATGGCGATGACCAAGTACAACATATTTCCCA";

branches/0.12-stable/yat/omic/BamRead.cc

@@ -187 +187 @@
   { return bam_->core; }
 
+
+  uint16_t BamRead::flag(void) const
+  {
+    return bam_->core.flag;
+  }
 
   const char* BamRead::name(void) const

branches/0.12-stable/yat/omic/BamRead.h

@@ -189 +189 @@
 
     /**
+       \brief rightmost coordinate
+
+       Coordinate is 0-based, i.e., the end is one passed the last
+       matching position.
+
+       \see bam_calend
+     */
+    int32_t end(void) const;
+
+    /**
+       \brief bitwise flag
+
+       \see Preprocessor defines BAM_F*
+
+       \since implemented since yat 0.12
+     */
+    uint16_t flag(void) const;
+
+    /**
+       \brief leftmost position for mate
+     */
+    int32_t mpos(void) const;
+
+    /**
+       \brief Chromosome ID for mate
+     */
+    int32_t mtid(void) const;
+
+    /**
+       \return query name
+
+       Length of array is described by core().l_qname
+     */
+    const char* name(void) const;
+
+    /**
+       \brief modify name
+
+       \since New in yat 0.11
+    */
+    void name(const std::string& n);
+
+    /**
+       \brief 0-based laftmost coordinate
+     */
+    int32_t pos(void) const;
+
+    /**
        \return Quality of base \a i
      */
@@ -204 +252 @@
 
     /**
-       \return query name
-
-       Length of array is described by core().l_qname
-     */
-    const char* name(void) const;
-
-    /**
-       \brief modify name
-
-       \since New in yat 0.11
-    */
-    void name(const std::string& n);
+       Each character in returned sequence is either A, C, G, T, or N.
+
+       \return sequence
+     */
+    std::string sequence(void) const;
+
+    /**
+       4-bit integer describing base \a index
+
+       \see bam_nt16_rev_table
+     */
+    uint8_t sequence(size_t index) const;
+
+    /**
+       \brief modify a base in sequence
+
+       Set i-th base in sequence to \a x, where seq is a 4-bit integer.
+
+       \see bam_nt16_table
+
+       \since New in yat 0.11
+     */
+    void sequence(size_t i, uint8_t x);
+
+    /**
+       \brief set sequence and quality
+
+       \since New in yat 0.11
+     */
+    void sequence(const std::string& seq, const std::vector<uint8_t>& qual);
+
+    /**
+       \see core().l_qseq
+     */
+    uint32_t sequence_length(void) const;
+
+    /**
+       Exchanging this read with \a other.
+
+       \see swap(BamRead&, BamRead&)
+     */
+    void swap(BamRead& other);
 
     /**
@@ -221 +299 @@
      */
     int32_t tid(void) const;
-
-    /**
-       \brief 0-based laftmost coordinate
-     */
-    int32_t pos(void) const;
-
-    /**
-       \brief rightmost coordinate
-
-       Coordinate is 0-based, i.e., the end is one passed the last
-       matching position.
-
-       \see bam_calend
-     */
-    int32_t end(void) const;
-
-    /**
-       \brief Chromosome ID for mate
-     */
-    int32_t mtid(void) const;
-
-    /**
-       \brief leftmost position for mate
-     */
-    int32_t mpos(void) const;
-
-    /**
-       Each character in returned sequence is either A, C, G, T, or N.
-
-       \return sequence
-     */
-    std::string sequence(void) const;
-
-    /**
-       4-bit integer describing base \a index
-
-       \see bam_nt16_rev_table
-     */
-    uint8_t sequence(size_t index) const;
-
-    /**
-       \brief modify a base in sequence
-
-       Set i-th base in sequence to \a x, where seq is a 4-bit integer.
-
-       \see bam_nt16_table
-
-       \since New in yat 0.11
-     */
-    void sequence(size_t i, uint8_t x);
-
-    /**
-       \brief set sequence and quality
-
-       \since New in yat 0.11
-     */
-    void sequence(const std::string& seq, const std::vector<uint8_t>& qual);
-
-    /**
-       \see core().l_qseq
-     */
-    uint32_t sequence_length(void) const;
-
-    /**
-       \brief bitwise flag
-
-       \see Preprocessor defines BAM_F*
-     */
-    uint16_t flag(void) const;
-
-    /**
-       Exchanging this read with \a other.
-
-       \see swap(BamRead&, BamRead&)
-     */
-    void swap(BamRead& other);
 
   private: