Changeset 3295

Timestamp:

Jul 25, 2014, 6:24:39 AM (9 years ago)

Author:

Peter

Message:

merge release 0.12 into trunk

Location:

trunk

Files:

• . (modified) (1 prop)
• NEWS (modified) (1 diff)
• configure.ac (modified) (2 diffs)
• doc/concepts.doxygen (modified) (26 diffs)
• test/Suite.h (modified) (1 diff)
• test/bam.cc (modified) (7 diffs)
• test/bam_pair_analyse.cc (modified) (2 diffs)
• test/bam_pair_iterator.cc (modified) (2 diffs)
• test/utility.cc (modified) (3 diffs)
• yat/classifier/DataLookupWeighted1D.h (modified) (1 diff)
• yat/classifier/KernelLookup.h (modified) (1 diff)
• yat/classifier/MatrixLookup.h (modified) (1 diff)
• yat/classifier/MatrixLookupWeighted.h (modified) (1 diff)
• yat/normalizer/RowNormalizer.h (modified) (2 diffs)
• yat/omic/BamPairIterator.h (modified) (3 diffs)
• yat/omic/BamRead.cc (modified) (3 diffs)
• yat/omic/BamRead.h (modified) (4 diffs)
• yat/omic/algorithm.h (modified) (1 diff)
• yat/statistics/KolmogorovSmirnov.h (modified) (1 diff)
• yat/utility/Aligner.cc (modified) (2 diffs)
• yat/utility/Container2DIterator.h (modified) (2 diffs)
• yat/utility/DataWeightProxy.h (modified) (3 diffs)
• yat/utility/GetlineIterator.cc (modified) (2 diffs)
• yat/utility/deprecate.h (modified) (1 diff)
• yat/utility/stl_utility.h (modified) (4 diffs)
• yat/utility/utility.cc (modified) (2 diffs)
• yat/utility/utility.h (modified) (3 diffs)

trunk/NEWS

@@ -13 +13 @@
 yat 0.12.x series from http://dev.thep.lu.se/yat/svn/branches/0.12-stable
 
-version 0.12 (released NOT YET)
+version 0.12 (released 25 July 2014)
+  - BamRead::cigar(const std::vector<uint32_t>&) is deprecated
   - Aligner(double, double) is now explicit (see r3207)
   - GetlineIterator(istream&, char) is now explicit (see r3148)
+  - rename(2) and remove(1) are now implemented (bug #804)
 
   A complete list of closed tickets can be found here [[br]]

trunk/configure.ac

@@ -10 +10 @@
 # Copyright (C) 2010, 2011 Peter Johansson
 # Copyright (C) 2012 Jari Häkkinen, Peter Johansson
-# Copyright (C) 2013, 2014 Peter Johansson
+# Copyright (C) 2013 Peter Johansson
+# Copyright (C) 2014 Jari Häkkinen, Peter Johansson
 #
 # This file is part of the yat library, http://dev.thep.lu.se/yat
@@ -460 +461 @@
 ])
 
+# When compiling boost::Mutable_*Iterator some versions of clang complains:
+# warning: unsequenced modification and access to 'i' [-Wunsequenced]
+# Test if compiler gives that warning, and if it does turn it off.
+yat_save_CXXFLAGS=$CXXFLAGS
+AC_MSG_CHECKING([whether 'boost/concept_check.hpp' causes compiler warnings])
+CXXFLAGS="$INTERNAL_CXXFLAGS $CXXFLAGS"
+AC_COMPILE_IFELSE([AC_LANG_PROGRAM(
+  [
+    @%:@include <boost/concept_check.hpp>
+  ],[
+    BOOST_CONCEPT_ASSERT((boost::Mutable_RandomAccessIterator<double* >));
+  ])
+], [ # IF-SUCCESSFUL
+  AC_MSG_RESULT([no])
+  # restore CXXFLAGS
+  CXXFLAGS=$yat_save_CXXFLAGS
+], [ # IF-FAILED
+  AC_MSG_RESULT([yes])
+  CXXFLAGS=$yat_save_CXXFLAGS
+  YAT_CXX_ADD_FLAG([CXXFLAGS], [-Wno-unsequenced])
+])
+
+
 AS_IF([test x$enable_debug = xyes], [
   # some versions of boost uses long long - turn off compiler warnings

trunk/doc/concepts.doxygen

@@ -2 +2 @@
 //
 // Copyright (C) 2008 Jari Häkkinen, Peter Johansson, Markus Ringnér
-// Copyright (C) 2009, 2010, 2011 Peter Johansson
+// Copyright (C) 2009, 2010, 2011, 2014 Peter Johansson
 //
 // This file is part of the yat library, http://dev.thep.lu.se/yat
@@ -37 +37 @@
 \page concept_container_2d Container2D
 
-\section Description
+\section concept_container_2d_description Description
 
 \ref concept_container_2d is a <a
@@ -46 +46 @@
 row.
 
-\section Requirements
+\section concept_container_2d_requirments Requirements
 
 A \ref concept_container_2d provides the following:
 
-\subsection Types
+\subsection concept_container_2d_types Types
 
 <table cellspacing=0 border=1>
@@ -62 +62 @@
 <tr>
 <td>Const iterator type</td>
-<td><tt>X::const_iterator</tt></td> 
+<td><tt>X::const_iterator</tt></td>
 <td>
 A read-only iterator that can be used to iterate over the entire \ref
@@ -72 +72 @@
 <tr>
 <td>Const column iterator type</td>
-<td><tt>X::const_column_iterator</tt></td> 
+<td><tt>X::const_column_iterator</tt></td>
 <td>
 A read-only iterator that can be used to examine the elements in one
@@ -80 +80 @@
 <tr>
 <td>Const row iterator type</td>
-<td><tt>X::const_row_iterator</tt></td> 
+<td><tt>X::const_row_iterator</tt></td>
 <td>
 A read-only iterator that can be used to examine the elements in one
@@ -88 +88 @@
 </table>
 
-\subsection public_functions Public Functions
+\subsection concept_container_2d_public_functions Public Functions
 
 <table cellspacing=0 border=1>
@@ -154 +154 @@
 <td>Element Access</td>
 <td><tt>a(size_t row, size_t column)</tt></td>
-<td><tt>0 &lt;= row &lt; a.rows()</tt> and 
+<td><tt>0 &lt;= row &lt; a.rows()</tt> and
 <tt>0 &lt;= column &lt; a.columns()</tt></td>
 <td><tt>const_reference</tt></td>
@@ -161 +161 @@
 </table>
 
-\section Implementations
+\section concept_container_2d_implementations Implementations
 
 Examples of concept \ref concept_container_2d include:
@@ -173 +173 @@
 \page concept_mutable_container_2d Mutable Container2D
 
-\section Description
+\section concept_mutable_container_2d_description Description
 
 \ref concept_mutable_container_2d is a \ref concept_container_2d that
 also provides non-const access to its elements.
 
-\section Requirements
+\section concept_mutable_container_2d_requirments Requirements
 
 In addition to the requirements defined in \ref concept_container_2d,
 a \ref concept_mutable_container_2d also provides the following:
 
-\subsection Types
+\subsection concept_mutable_container_2d_types Types
 
 <table cellspacing=0 border=1>
@@ -192 +192 @@
 <tr>
 <td>Iterator type</td>
-<td><tt>X::iterator</tt></td> 
+<td><tt>X::iterator</tt></td>
 <td>
 
@@ -204 +204 @@
 <tr>
 <td>Column iterator type</td>
-<td><tt>X::column_iterator</tt></td> 
+<td><tt>X::column_iterator</tt></td>
 <td>
 A mutable iterator that can be used to modify the elements in one
@@ -212 +212 @@
 <tr>
 <td>Row iterator type</td>
-<td><tt>X::row_iterator</tt></td> 
+<td><tt>X::row_iterator</tt></td>
 <td>
 A mutable iterator that can be used to modify the elements in one
@@ -220 +220 @@
 </table>
 
-\subsection public_functions Public Functions
+\subsection concept_mutable_container_2d_public_functions Public Functions
 
 <table cellspacing=0 border=1>
@@ -272 +272 @@
 <td>Element Access</td>
 <td><tt>a(size_t row, size_t column)</tt></td>
-<td><tt>0 &lt;= row &lt; a.rows()</tt> and 
+<td><tt>0 &lt;= row &lt; a.rows()</tt> and
 <tt>0 &lt;= column &lt; a.columns()</tt></td>
 <td><tt>reference</tt></td>
@@ -279 +279 @@
 </table>
 
-\section Implementations
+\section concept_mutable_container_2d_implementations Implementations
 
 Examples of concept \ref concept_mutable_container_2d include:
@@ -290 +290 @@
 \page concept_distance Distance
 
-\section Description
+\section concept_distance_description Description
 
 \ref concept_distance is a concept for classes implementing different
 alternatives to calculate the distance between two points.
 
-\section Requirements
+\section concept_distance_requirments Requirements
 
 Classes modelling the concept \ref concept_distance should have a copy
-constructor 
+constructor
 
 \verbatim
@@ -320 +320 @@
 have both a value and a weight. The selection between unweighted and
 weighted implementations should utilize
-theplu::yat::utility::unweighted_iterator_tag and 
+theplu::yat::utility::unweighted_iterator_tag and
 theplu::yat::utility::weighted_iterator_tag. Moreover
 theplu::yat::utility::weighted_if_any2 should be utilized to provide a
@@ -326 +326 @@
 unweighted implementation when both ranges are unweighted.
 
-\section Implementations
+\section concept_distance_implementations Implementations
 
 Examples of classes modelling the concept \ref concept_distance
@@ -339 +339 @@
 \page concept_neighbor_weighting Neighbor Weighting Method
 
-\section Description
+\section concept_neighbor_weighting_description Description
 
 \ref concept_neighbor_weighting is a concept used in connection with
@@ -345 +345 @@
 NeighborWeighting should implement this concept.
 
-\section Requirements
+\section concept_neighbor_weighting_requirements Requirements
 
 Classes modelling the concept \ref concept_neighbor_weighting should
-be DefaultConstructible and Assignable as well as 
+be DefaultConstructible and Assignable as well as
 implement the following public function:
-  
-\verbatim   
-void operator()(const utility::VectorBase& distance, 
+
+\verbatim
+void operator()(const utility::VectorBase& distance,
                 const std::vector<size_t>& k_sorted,
-                const Target& target, 
+                const Target& target,
                 utility::VectorMutable& prediction) const
 \endverbatim
@@ -371 +371 @@
 neighbors with distance infinity do not vote.
 
-\section Implementations
+\section concept_neighbor_weighting_implementations Implementations
 
 Examples of classes modelling the concept \ref
@@ -384 +384 @@
 \page concept_weighted_iterator Weighted Iterator
 
-\section Description
+\section concept_weighted_iterator_description Description
 
 Most functionality in yat come in two versions: one optimized for
@@ -396 +396 @@
 Access Iterator.
 
-\section Requirements
+\section concept_weighted_iterator_requirements Requirements
 
 When implementing a new iterator that may be a \ref
@@ -443 +443 @@
 \page concept_data_iterator Data Iterator
 
-\section Description
-
-\ref concept_data_iterator is an iterator that is either: 
+\section concept_data_iterator_description Description
+
+\ref concept_data_iterator is an iterator that is either:
 
   - a \ref concept_weighted_iterator with value type convertible to
@@ -451 +451 @@
   - an unweighted iterator with value type convertible to \c double.
 
-\section Implementations
+\section concept_data_iterator_implementations Implementations
 
 Examples of concept \ref concept_data_iterator include:

trunk/test/Suite.h

@@ -413 +413 @@
     add(tmp==*iter);
     TrivialIterator default_constructed;
-    default_constructed == default_constructed; // avoid compiler warning
+    dummie_function(default_constructed);
   }
 

trunk/test/bam.cc

@@ -24 +24 @@
 #include "yat/omic/BamRead.h"
 #endif
+
+#include "yat/utility/Aligner.h"
 
 #include <cassert>
@@ -54 +56 @@
   suite.out() << "size: " << size << " " << bam.aux_size() << "\n";
   suite.add(bam.aux_size() == size+4);
+  bam.aux();
   bam.aux("ZZ");
   char c1 = bam_aux2A(bam.aux("ZZ"));
@@ -68 +71 @@
   BamRead bam(b);
 
+  bam.cigar();
+  bam.cigar(0);
+  bam.cigar_op(0);
+  bam.cigar_oplen(0);
+
   suite.out() << "test cigar:\n";
   suite.out() << bam.cigar_str() << "\n";
   OutBamFile os("cigar_test.bam", hdr);
-  std::vector<uint32_t> cig;
+  utility::Aligner::Cigar cig;
 
   bam.cigar(cig);
@@ -78 +86 @@
   os.write(bam);
 
-  cig.resize(1);
-  cig[0] = bam_cigar_gen(bam.sequence_length(), BAM_CMATCH);
+  cig.push_back(BAM_CMATCH, bam.sequence_length());
   bam.cigar(cig);
   suite.out() << bam.cigar_str() << "\n";
@@ -85 +92 @@
   os.write(bam);
 
-  cig.resize(3);
-  cig[0] = bam_cigar_gen(50, BAM_CMATCH);
-  cig[1] = bam_cigar_gen(2, BAM_CDEL);
-  cig[2] = bam_cigar_gen(50, BAM_CMATCH);
+  cig.clear();
+  cig.push_back(BAM_CMATCH, 50);
+  cig.push_back(BAM_CDEL, 2);
+  cig.push_back(BAM_CMATCH, 50);
   bam.cigar(cig);
   suite.out() << bam.cigar_str() << "\n";
@@ -132 +139 @@
 
   // just for consistency
-  std::vector<uint32_t> cig;
+  utility::Aligner::Cigar cig;
   bam.cigar(cig);
   bam.core().flag &= ~BAM_FUNMAP;
@@ -226 +233 @@
   BamRead bam;
   in.read(bam);
+  // test that functions are implemented
+  bam.end();
+  bam.flag();
+  bam.mpos();
+  bam.mtid();
+  bam.pos();
+  bam.tid();
+  bam.swap(bam);
   std::string str = "AGCTTTGTTATTATTTGAGGGTGTGGTTCAGTTGTAAACAGTGTATG"
     "TTTTAGAATTTGTGTTATTGTGATGGCGATGACCAAGTACAACATATTTCCCA";

trunk/test/bam_pair_analyse.cc

@@ -18 +18 @@
 #include <config.h>
 
-#include "Suite.h"
-
-using namespace theplu::yat;
-
 #if YAT_HAVE_LIBBAM
 #include "yat/omic/algorithm.h"
@@ -27 +23 @@
 #include "yat/omic/BamReadIterator.h"
 #endif
+
+// include Suite.h late to see that algorithm.h is OK to include
+// first. See ticket #793.
+#include "Suite.h"
+using namespace theplu::yat;
 
 void test1(test::Suite& suite);

trunk/test/bam_pair_iterator.cc

@@ -18 +18 @@
 #include <config.h>
 
-#include "Suite.h"
-
 #ifdef YAT_HAVE_LIBBAM
 #include "yat/omic/BamFile.h"
@@ -31 +29 @@
 #include <cassert>
 #include <string>
+
+// include Suite.h late to expose bug #797
+#include "Suite.h"
 
 using namespace theplu::yat;

trunk/test/utility.cc

@@ -59 +59 @@
 void test_fnmatch(test::Suite& suite);
 bool test_fnmatch(bool, std::string, std::string);
+void test_remove(test::Suite& suite);
+void test_rename(test::Suite& suite);
 void test_replace(test::Suite& suite);
 
@@ -221 +223 @@
   test_dirname(suite);
   test_fnmatch(suite);
+  test_remove(suite);
+  test_rename(suite);
   test_replace(suite);
 
@@ -725 +729 @@
 
 
+void test_remove(test::Suite& suite)
+{
+  // at least test linking
+  if (false)
+    utility::remove("foo");
+}
+
+
+void test_rename(test::Suite& suite)
+{
+  // at least test linking
+  if (false)
+    utility::rename("foo", "bar");
+}
+
+
 void test_replace(test::Suite& suite)
 {

trunk/yat/classifier/DataLookupWeighted1D.h

@@ -7 +7 @@
   Copyright (C) 2006 Jari Häkkinen, Peter Johansson
   Copyright (C) 2007, 2008 Jari Häkkinen, Peter Johansson, Markus Ringnér
-  Copyright (C) 2009 Peter Johansson
+  Copyright (C) 2009, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/classifier/KernelLookup.h

@@ -8 +8 @@
   Copyright (C) 2006 Jari Häkkinen, Peter Johansson, Markus Ringnér
   Copyright (C) 2007, 2008 Jari Häkkinen, Peter Johansson
-  Copyright (C) 2010, 2012 Peter Johansson
+  Copyright (C) 2010, 2012, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/classifier/MatrixLookup.h

@@ -8 +8 @@
   Copyright (C) 2006 Jari Häkkinen, Peter Johansson, Markus Ringnér
   Copyright (C) 2007, 2008 Jari Häkkinen, Peter Johansson
-  Copyright (C) 2009, 2010, 2012 Peter Johansson
+  Copyright (C) 2009, 2010, 2012, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/classifier/MatrixLookupWeighted.h

@@ -7 +7 @@
   Copyright (C) 2006 Jari Häkkinen, Peter Johansson, Markus Ringnér
   Copyright (C) 2007, 2008 Jari Häkkinen, Peter Johansson
-  Copyright (C) 2009, 2010, 2012 Peter Johansson
+  Copyright (C) 2009, 2010, 2012, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/normalizer/RowNormalizer.h

@@ -1 +1 @@
 #ifndef _theplu_yat_normalizer_row_normalizer_
-#define _theplu_yat_normalizer_rows_normalizer_
+#define _theplu_yat_normalizer_row_normalizer_
 
 // $Id$
@@ -6 +6 @@
 /*
   Copyright (C) 2008 Jari Häkkinen, Peter Johansson
-  Copyright (C) 2009, 2010 Peter Johansson
+  Copyright (C) 2009, 2010, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/omic/BamPairIterator.h

@@ -30 +30 @@
 
 #include <boost/concept/assert.hpp>
+#include <boost/iterator/iterator_concepts.hpp>
 #include <boost/iterator/iterator_facade.hpp>
 #include <boost/shared_ptr.hpp>
@@ -157 +158 @@
     BOOST_CONCEPT_ASSERT((boost::InputIterator<Base>));
     using boost::Convertible;
-    typedef typename std::iterator_traits<Base>::reference reference_type;
-    BOOST_CONCEPT_ASSERT((Convertible<reference_type, BamRead>));
+    typedef typename std::iterator_traits<Base>::value_type value_type;
+    BOOST_CONCEPT_ASSERT((Convertible<value_type, BamRead>));
     find_next();
   }
@@ -168 +169 @@
     BOOST_CONCEPT_ASSERT((boost::InputIterator<Base>));
     using boost::Convertible;
-    typedef typename std::iterator_traits<Base>::reference reference_type;
-    BOOST_CONCEPT_ASSERT((Convertible<reference_type, BamRead>));
+    typedef typename std::iterator_traits<Base>::value_type value_type;
+    BOOST_CONCEPT_ASSERT((Convertible<value_type, BamRead>));
   }
 

trunk/yat/omic/BamRead.cc

@@ -149 +149 @@
 
   void BamRead::cigar(const std::vector<uint32_t>& c)
+  {
+    // use the new function cigar(1) to implement this old deprecated variant
+    utility::Aligner::Cigar cig;
+    for (size_t i=0; i<c.size(); ++i)
+      cig.push_back(bam_cigar_op(c[i]), bam_cigar_oplen(c[i]));
+    cigar(cig);
+  }
+
+
+  void BamRead::cigar(const utility::Aligner::Cigar& c)
   {
     int offset = 4*c.size() - 4*core().n_cigar;
@@ -161 +171 @@
 
     // copy new cigar
-    if (c.size())
-      // each cigar element is 4 bytes
-      memcpy(bam1_cigar(bam_), &c[0], 4*c.size());
+    for (size_t i=0; i<c.size(); ++i)
+      bam1_cigar(bam_)[i] = c[i];
+
     bam_->data_len += offset;
     core().n_cigar = c.size();
@@ -177 +187 @@
   { return bam_->core; }
 
+
+  uint16_t BamRead::flag(void) const
+  {
+    return bam_->core.flag;
+  }
 
   const char* BamRead::name(void) const

trunk/yat/omic/BamRead.h

@@ -27 +27 @@
 #include YAT_SAM_HEADER
 
+#include "yat/utility/Aligner.h"
 // This file has to be included to keep compatibility with yat 0.11
-#include <yat/utility/Cigar.h>
+#include "yat/utility/Cigar.h"
+#include "yat/utility/deprecate.h"
 
 #include <functional>
@@ -171 +173 @@
 
        \param c new cigar
+
+       \deprecated Provided for backward compatibility with 0.11
+       API. Use cigar(const utility::Aligner::Cigar&) instead.
     */
-    void cigar(const std::vector<uint32_t>& c);
+    void cigar(const std::vector<uint32_t>& c) YAT_DEPRECATE;
+
+    /**
+       \brief set CIGAR
+
+       \param cigar new cigar
+
+       \since new in yat 0.12
+    */
+    void cigar(const utility::Aligner::Cigar& cigar);
+
+    /**
+       \brief rightmost coordinate
+
+       Coordinate is 0-based, i.e., the end is one passed the last
+       matching position.
+
+       \see bam_calend
+     */
+    int32_t end(void) const;
+
+    /**
+       \brief bitwise flag
+
+       \see Preprocessor defines BAM_F*
+
+       \since implemented since yat 0.12
+     */
+    uint16_t flag(void) const;
+
+    /**
+       \brief leftmost position for mate
+     */
+    int32_t mpos(void) const;
+
+    /**
+       \brief Chromosome ID for mate
+     */
+    int32_t mtid(void) const;
+
+    /**
+       \return query name
+
+       Length of array is described by core().l_qname
+     */
+    const char* name(void) const;
+
+    /**
+       \brief modify name
+
+       \since New in yat 0.11
+    */
+    void name(const std::string& n);
+
+    /**
+       \brief 0-based laftmost coordinate
+     */
+    int32_t pos(void) const;
 
     /**
@@ -190 +252 @@
 
     /**
-       \return query name
-
-       Length of array is described by core().l_qname
-     */
-    const char* name(void) const;
-
-    /**
-       \brief modify name
-
-       \since New in yat 0.11
-    */
-    void name(const std::string& n);
+       Each character in returned sequence is either A, C, G, T, or N.
+
+       \return sequence
+     */
+    std::string sequence(void) const;
+
+    /**
+       4-bit integer describing base \a index
+
+       \see bam_nt16_rev_table
+     */
+    uint8_t sequence(size_t index) const;
+
+    /**
+       \brief modify a base in sequence
+
+       Set i-th base in sequence to \a x, where seq is a 4-bit integer.
+
+       \see bam_nt16_table
+
+       \since New in yat 0.11
+     */
+    void sequence(size_t i, uint8_t x);
+
+    /**
+       \brief set sequence and quality
+
+       \since New in yat 0.11
+     */
+    void sequence(const std::string& seq, const std::vector<uint8_t>& qual);
+
+    /**
+       \see core().l_qseq
+     */
+    uint32_t sequence_length(void) const;
+
+    /**
+       Exchanging this read with \a other.
+
+       \see swap(BamRead&, BamRead&)
+     */
+    void swap(BamRead& other);
 
     /**
@@ -207 +299 @@
      */
     int32_t tid(void) const;
-
-    /**
-       \brief 0-based laftmost coordinate
-     */
-    int32_t pos(void) const;
-
-    /**
-       \brief rightmost coordinate
-
-       Coordinate is 0-based, i.e., the end is one passed the last
-       matching position.
-
-       \see bam_calend
-     */
-    int32_t end(void) const;
-
-    /**
-       \brief Chromosome ID for mate
-     */
-    int32_t mtid(void) const;
-
-    /**
-       \brief leftmost position for mate
-     */
-    int32_t mpos(void) const;
-
-    /**
-       Each character in returned sequence is either A, C, G, T, or N.
-
-       \return sequence
-     */
-    std::string sequence(void) const;
-
-    /**
-       4-bit integer describing base \a index
-
-       \see bam_nt16_rev_table
-     */
-    uint8_t sequence(size_t index) const;
-
-    /**
-       \brief modify a base in sequence
-
-       Set i-th base in sequence to \a x, where seq is a 4-bit integer.
-
-       \see bam_nt16_table
-
-       \since New in yat 0.11
-     */
-    void sequence(size_t i, uint8_t x);
-
-    /**
-       \brief set sequence and quality
-
-       \since New in yat 0.11
-     */
-    void sequence(const std::string& seq, const std::vector<uint8_t>& qual);
-
-    /**
-       \see core().l_qseq
-     */
-    uint32_t sequence_length(void) const;
-
-    /**
-       \brief bitwise flag
-
-       \see Preprocessor defines BAM_F*
-     */
-    uint16_t flag(void) const;
-
-    /**
-       Exchanging this read with \a other.
-
-       \see swap(BamRead&, BamRead&)
-     */
-    void swap(BamRead& other);
 
   private:

trunk/yat/omic/algorithm.h

@@ -24 +24 @@
 
 #include "BamPairIterator.h"
-#include "BamRead.h"
-#include "GenomicPosition.h"
-
-#include <boost/concept/assert.hpp>
-
-#include <iterator>
-#include <map>
-#include <string>
-#include <utility>
 
 namespace theplu {

trunk/yat/statistics/KolmogorovSmirnov.h

@@ -214 +214 @@
   {
     BOOST_CONCEPT_ASSERT((boost::ForwardIterator<ForwardIterator>));
-    typedef typename std::iterator_traits<ForwardIterator>::reference ref;
-    BOOST_CONCEPT_ASSERT((boost::Convertible<ref, KolmogorovSmirnov::Element>));
     ForwardIterator iter(first);
     typename data_w::const_iterator hint(data_.begin());

trunk/yat/utility/Aligner.cc

@@ -2 +2 @@
 
 /*
-  Copyright (C) 2012, 2014 Peter Johansson
+  Copyright (C) 2012 Peter Johansson
+  Copyright (C) 2014 Jari Häkkinen, Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat
@@ -28 +29 @@
 #include <cassert>
 #include <limits>
+#include <ostream>
 
 namespace theplu {

trunk/yat/utility/Container2DIterator.h

@@ -76 +76 @@
     {
       BOOST_CONCEPT_ASSERT((Container2D<Container>));
-      BOOST_CONCEPT_ASSERT((boost::Convertible<reference,value>));
     };
 
@@ -90 +89 @@
     {
       BOOST_CONCEPT_ASSERT((Container2D<Container>));
-      BOOST_CONCEPT_ASSERT((boost::Convertible<reference,value>));
     }
 

trunk/yat/utility/DataWeightProxy.h

@@ -65 +65 @@
       // DataIterator::value must be convertible to double
       BOOST_CONCEPT_ASSERT((Convertible<data_type, double>));
-      // this is for function data(void) const
-      BOOST_CONCEPT_ASSERT((Convertible<data_reference, const double&>));
 
       // same check for WeightIterator
       BOOST_CONCEPT_ASSERT((Convertible<weight_type, double>));
-      BOOST_CONCEPT_ASSERT((Convertible<weight_reference, const double&>));
     }
 
@@ -85 +82 @@
     typename std::iterator_traits<DataIterator>::reference data(void) 
     { 
-      BOOST_CONCEPT_ASSERT((boost::Convertible<data_reference, double>));
       return *data_; 
     }
@@ -106 +102 @@
     typename std::iterator_traits<WeightIterator>::reference weight(void) 
     { 
-      BOOST_CONCEPT_ASSERT((boost::Convertible<weight_reference, double>));
       return *weight_; 
     }

trunk/yat/utility/GetlineIterator.cc

@@ -3 +3 @@
 /*
   Copyright (C) 2009, 2012 Peter Johansson
+  Copyright (C) 2014 Jari Häkkinen
 
   This file is part of the yat library, http://dev.thep.lu.se/yat
@@ -25 +26 @@
 #include "GetlineIterator.h"
 
+#include <istream>
 #include <string>
 

trunk/yat/utility/deprecate.h

@@ -1 +1 @@
 #ifndef _theplu_yat_utility_deprecate_
-#define _theplu_yat_utility_deprecate_ 
+#define _theplu_yat_utility_deprecate_
 
 // $Id$
 
 /*
-  Copyright (C) 2008, 2009 Peter Johansson
+  Copyright (C) 2008, 2009, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat

trunk/yat/utility/stl_utility.h

@@ -181 +181 @@
       : f_(f), g_(g), h_(h)
     {
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename G::result_type
-                            , typename F::first_argument_type>));
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename H::result_type
-                            , typename F::second_argument_type>));
-
     }
 
@@ -258 +253 @@
       : f_(f), g_(g)
     {
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename G::result_type
-                            , typename F::argument_type>));
     }
 
@@ -334 +327 @@
       : f_(f), g_(g)
     {
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename G::result_type
-                            , typename F::argument_type>));
     }
 
@@ -412 +403 @@
       : f_(f), g_(g), h_(h)
     {
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename G::result_type
-                            , typename F::first_argument_type>));
-      BOOST_CONCEPT_ASSERT((boost::Convertible<typename H::result_type
-                            , typename F::second_argument_type>));
     }
 

trunk/yat/utility/utility.cc

@@ -4 +4 @@
   Copyright (C) 2005, 2006 Jari Häkkinen, Markus Ringnér
   Copyright (C) 2007, 2008 Jari Häkkinen, Peter Johansson
-  Copyright (C) 2010, 2012, 2013 Peter Johansson
+  Copyright (C) 2010, 2012, 2013, 2014 Peter Johansson
 
   This file is part of the yat library, http://dev.thep.lu.se/yat
@@ -183 +183 @@
     mkdir_p(dirname(dir), mode);
     mkdir(dir, mode);
+  }
+
+
+  void remove(const std::string& fn)
+  {
+    if (::remove(fn.c_str())) {
+      std::string msg("remove: ");
+      msg += fn;
+      throw errno_error(msg);
+    }
+  }
+
+
+  void rename(const std::string& from, const std::string& to)
+  {
+    if (::rename(from.c_str(), to.c_str())) {
+      std::stringstream ss;
+      ss << "rename" << from << " to " << to << ": ";
+      throw errno_error(ss.str());
+    }
   }
 

trunk/yat/utility/utility.h

@@ -306 +306 @@
      \see http://linux.die.net/man/3/remove
 
-     \since New in yat 0.10
+     \since New in yat 0.12
    */
   void remove(const std::string& fn);
@@ -316 +316 @@
      \see http://linux.die.net/man/3/rename
 
-     \since New in yat 0.10
+     \since New in yat 0.12
    */
   void rename(const std::string& from, const std::string to);
@@ -420 +420 @@
 /// \endcond
 
+
+     No error if \a dir already exist. Make parent directories as needed.
+
+     \since New in yat 0.10
+   */
+  void mkdir_p(const std::string& dir, mode_t mode=0777);
+
+  /**
+     same as C function remove but throws errno_error at failure
+
+     \see http://linux.die.net/man/3/remove
+
+     \since New in yat 0.12
+   */
+  void remove(const std::string& fn);
+
+  /**
+     same as C function with same name but throws errno_error if error
+     is encountered
+
+     \see http://linux.die.net/man/3/rename
+
+     \since New in yat 0.12
+   */
+  void rename(const std::string& from, const std::string& to);
+
+  /**
+     In \a full_str replace every sub-string \a old_str with \a
+     new_str;
+
+     \since New in yat 0.10
+   */
+  void replace(std::string& full_str, std::string old_str, std::string new_str);
 
   // template implementations