Opened 9 years ago

Closed 9 years ago

#820 closed defect (fixed)

Unexpected CIGAR

Reported by: Peter Owned by: Peter
Priority: major Milestone: yat 0.12.2
Component: utility Version: 0.12
Keywords: Cc:

Description

I use Smithwaterman to align a query against ref as below with gap=2, open_gap=5 and mismatch=3 

ref: AAAGACTTACGATGAGGTCTGGCACCCTGAGCAGTCCAGCGAGGACTTGGTCTTAGTTGAGCAATTTGGCTAGGAGGATA
query: ATATTTTGGAATGGATGAGGTCTGGCACCCTGAGCAGTCCAGCGAGGACTTGGTCTTAGCTGAGCAATTTGG

and get

CIGAR: '11S2X46=1X12='; and alignment score: 55, which doesn't really make sense because why would you align a mismatch at the end of a sequence when you can soft-clip, i.e., I'd expect CIGAR: '13S46=1X12='. Also the alignment score 55 is not consistent with the CIGAR since -2*3+46-3+12=49 whereas the expected CIGAR corresponds to 55=46+12-3.

Change History (2)

comment:1 Changed 9 years ago by Peter

Milestone: yat 0.x+ → yat 0.12.2
Status: new → assigned

comment:2 Changed 9 years ago by Peter

Resolution: → fixed
Status: assigned → closed

(In [3339]) Fix problem that Aligner::member_ is not cleared to 'none' before aligning, which means that the beginning of alignment could be incorrect. Fixes #820.

Note: See TracTickets for help on using tickets.